ID: 1155607003

View in Genome Browser
Species Human (GRCh38)
Location 18:27617805-27617827
Sequence CTGAGTCAATGTCATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155607003_1155607005 27 Left 1155607003 18:27617805-27617827 CCTACTTTATGACATTGACTCAG No data
Right 1155607005 18:27617855-27617877 ACCTTGTATCTCTCAAATGAAGG No data
1155607003_1155607004 -1 Left 1155607003 18:27617805-27617827 CCTACTTTATGACATTGACTCAG No data
Right 1155607004 18:27617827-27617849 GATGTTTTCTCAATTCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155607003 Original CRISPR CTGAGTCAATGTCATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr