ID: 1155610040

View in Genome Browser
Species Human (GRCh38)
Location 18:27656453-27656475
Sequence CTGAACAATAACACTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155610040_1155610042 10 Left 1155610040 18:27656453-27656475 CCTACAAAAGTGTTATTGTTCAG No data
Right 1155610042 18:27656486-27656508 GTGACAAAATGTCCCAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155610040 Original CRISPR CTGAACAATAACACTTTTGT AGG (reversed) Intergenic
No off target data available for this crispr