ID: 1155611743

View in Genome Browser
Species Human (GRCh38)
Location 18:27674192-27674214
Sequence TCCAGCTGGCTGGCAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155611731_1155611743 20 Left 1155611731 18:27674149-27674171 CCGCTCGGAATGCGGGGCCCGCC No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611734_1155611743 2 Left 1155611734 18:27674167-27674189 CCGCCAAGCCTCGCCCACCCGGA No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611735_1155611743 -1 Left 1155611735 18:27674170-27674192 CCAAGCCTCGCCCACCCGGAACT No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611725_1155611743 28 Left 1155611725 18:27674141-27674163 CCACCCGGCCGCTCGGAATGCGG No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611730_1155611743 24 Left 1155611730 18:27674145-27674167 CCGGCCGCTCGGAATGCGGGGCC No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611732_1155611743 3 Left 1155611732 18:27674166-27674188 CCCGCCAAGCCTCGCCCACCCGG No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611736_1155611743 -6 Left 1155611736 18:27674175-27674197 CCTCGCCCACCCGGAACTCCAGC 0: 451
1: 393
2: 420
3: 442
4: 606
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611724_1155611743 29 Left 1155611724 18:27674140-27674162 CCCACCCGGCCGCTCGGAATGCG No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data
1155611729_1155611743 25 Left 1155611729 18:27674144-27674166 CCCGGCCGCTCGGAATGCGGGGC No data
Right 1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155611743 Original CRISPR TCCAGCTGGCTGGCAAGCGC CGG Intergenic
No off target data available for this crispr