ID: 1155613222

View in Genome Browser
Species Human (GRCh38)
Location 18:27692667-27692689
Sequence GGTCCCTGTGTCCCTCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155613217_1155613222 -7 Left 1155613217 18:27692651-27692673 CCCAGAGTCCCCTGGGGGTCCCT No data
Right 1155613222 18:27692667-27692689 GGTCCCTGTGTCCCTCTTGCAGG No data
1155613218_1155613222 -8 Left 1155613218 18:27692652-27692674 CCAGAGTCCCCTGGGGGTCCCTG No data
Right 1155613222 18:27692667-27692689 GGTCCCTGTGTCCCTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155613222 Original CRISPR GGTCCCTGTGTCCCTCTTGC AGG Intergenic