ID: 1155613222 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:27692667-27692689 |
Sequence | GGTCCCTGTGTCCCTCTTGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1155613217_1155613222 | -7 | Left | 1155613217 | 18:27692651-27692673 | CCCAGAGTCCCCTGGGGGTCCCT | No data | ||
Right | 1155613222 | 18:27692667-27692689 | GGTCCCTGTGTCCCTCTTGCAGG | No data | ||||
1155613218_1155613222 | -8 | Left | 1155613218 | 18:27692652-27692674 | CCAGAGTCCCCTGGGGGTCCCTG | No data | ||
Right | 1155613222 | 18:27692667-27692689 | GGTCCCTGTGTCCCTCTTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1155613222 | Original CRISPR | GGTCCCTGTGTCCCTCTTGC AGG | Intergenic | ||