ID: 1155615217

View in Genome Browser
Species Human (GRCh38)
Location 18:27714348-27714370
Sequence CTGAATATACAAATGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155615211_1155615217 14 Left 1155615211 18:27714311-27714333 CCCCAAGGTCAGCCACAAGAGTA No data
Right 1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG No data
1155615213_1155615217 12 Left 1155615213 18:27714313-27714335 CCAAGGTCAGCCACAAGAGTATT No data
Right 1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG No data
1155615214_1155615217 2 Left 1155615214 18:27714323-27714345 CCACAAGAGTATTAACCCTGAGA No data
Right 1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG No data
1155615212_1155615217 13 Left 1155615212 18:27714312-27714334 CCCAAGGTCAGCCACAAGAGTAT No data
Right 1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG No data
1155615209_1155615217 24 Left 1155615209 18:27714301-27714323 CCCAACACTTCCCCAAGGTCAGC No data
Right 1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG No data
1155615210_1155615217 23 Left 1155615210 18:27714302-27714324 CCAACACTTCCCCAAGGTCAGCC No data
Right 1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG No data
1155615207_1155615217 30 Left 1155615207 18:27714295-27714317 CCTAGTCCCAACACTTCCCCAAG No data
Right 1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155615217 Original CRISPR CTGAATATACAAATGAACAA TGG Intergenic
No off target data available for this crispr