ID: 1155615356

View in Genome Browser
Species Human (GRCh38)
Location 18:27715725-27715747
Sequence CTGTAACATCAGAAGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155615356_1155615367 9 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615367 18:27715757-27715779 TGGACCCAGGGTGGTGTTAGGGG No data
1155615356_1155615366 8 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615366 18:27715756-27715778 ATGGACCCAGGGTGGTGTTAGGG No data
1155615356_1155615370 13 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615370 18:27715761-27715783 CCCAGGGTGGTGTTAGGGGTGGG No data
1155615356_1155615372 16 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615372 18:27715764-27715786 AGGGTGGTGTTAGGGGTGGGAGG No data
1155615356_1155615373 17 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615373 18:27715765-27715787 GGGTGGTGTTAGGGGTGGGAGGG No data
1155615356_1155615362 -3 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615362 18:27715745-27715767 CAGCCTTGAGGATGGACCCAGGG No data
1155615356_1155615361 -4 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615361 18:27715744-27715766 ACAGCCTTGAGGATGGACCCAGG No data
1155615356_1155615365 7 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615365 18:27715755-27715777 GATGGACCCAGGGTGGTGTTAGG No data
1155615356_1155615368 12 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615368 18:27715760-27715782 ACCCAGGGTGGTGTTAGGGGTGG No data
1155615356_1155615364 0 Left 1155615356 18:27715725-27715747 CCTCCCTACTTCTGATGTTACAG No data
Right 1155615364 18:27715748-27715770 CCTTGAGGATGGACCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155615356 Original CRISPR CTGTAACATCAGAAGTAGGG AGG (reversed) Intergenic
No off target data available for this crispr