ID: 1155617264

View in Genome Browser
Species Human (GRCh38)
Location 18:27736910-27736932
Sequence CTTTTCTGCTTGAAGTGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155617263_1155617264 3 Left 1155617263 18:27736884-27736906 CCAGCTTTCTGGGGCTCTTTCAT No data
Right 1155617264 18:27736910-27736932 CTTTTCTGCTTGAAGTGTATAGG No data
1155617262_1155617264 10 Left 1155617262 18:27736877-27736899 CCAGATTCCAGCTTTCTGGGGCT No data
Right 1155617264 18:27736910-27736932 CTTTTCTGCTTGAAGTGTATAGG No data
1155617258_1155617264 24 Left 1155617258 18:27736863-27736885 CCAGGCTGGGAGCTCCAGATTCC No data
Right 1155617264 18:27736910-27736932 CTTTTCTGCTTGAAGTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155617264 Original CRISPR CTTTTCTGCTTGAAGTGTAT AGG Intergenic
No off target data available for this crispr