ID: 1155620429

View in Genome Browser
Species Human (GRCh38)
Location 18:27772094-27772116
Sequence CTGTGGCCCCAAAGGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155620424_1155620429 -6 Left 1155620424 18:27772077-27772099 CCTATTAGAATTATAGACTGTGG No data
Right 1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG No data
1155620423_1155620429 -5 Left 1155620423 18:27772076-27772098 CCCTATTAGAATTATAGACTGTG No data
Right 1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155620429 Original CRISPR CTGTGGCCCCAAAGGGATGG TGG Intergenic
No off target data available for this crispr