ID: 1155623348

View in Genome Browser
Species Human (GRCh38)
Location 18:27806861-27806883
Sequence CAGTGCAAAGAATCTGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155623347_1155623348 -6 Left 1155623347 18:27806844-27806866 CCTGAGAAATCTACAGTCAGTGC No data
Right 1155623348 18:27806861-27806883 CAGTGCAAAGAATCTGATGCCGG No data
1155623346_1155623348 2 Left 1155623346 18:27806836-27806858 CCAAGGAGCCTGAGAAATCTACA No data
Right 1155623348 18:27806861-27806883 CAGTGCAAAGAATCTGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155623348 Original CRISPR CAGTGCAAAGAATCTGATGC CGG Intergenic
No off target data available for this crispr