ID: 1155625593

View in Genome Browser
Species Human (GRCh38)
Location 18:27830928-27830950
Sequence GTTAGACATGTCAAGTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155625593_1155625595 -4 Left 1155625593 18:27830928-27830950 CCATACTACTTGACATGTCTAAC No data
Right 1155625595 18:27830947-27830969 TAACACCAATATCATTTCTTGGG No data
1155625593_1155625594 -5 Left 1155625593 18:27830928-27830950 CCATACTACTTGACATGTCTAAC No data
Right 1155625594 18:27830946-27830968 CTAACACCAATATCATTTCTTGG No data
1155625593_1155625599 7 Left 1155625593 18:27830928-27830950 CCATACTACTTGACATGTCTAAC No data
Right 1155625599 18:27830958-27830980 TCATTTCTTGGGAAAGGTATGGG No data
1155625593_1155625597 1 Left 1155625593 18:27830928-27830950 CCATACTACTTGACATGTCTAAC No data
Right 1155625597 18:27830952-27830974 CCAATATCATTTCTTGGGAAAGG No data
1155625593_1155625598 6 Left 1155625593 18:27830928-27830950 CCATACTACTTGACATGTCTAAC No data
Right 1155625598 18:27830957-27830979 ATCATTTCTTGGGAAAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155625593 Original CRISPR GTTAGACATGTCAAGTAGTA TGG (reversed) Intergenic
No off target data available for this crispr