ID: 1155626248

View in Genome Browser
Species Human (GRCh38)
Location 18:27838267-27838289
Sequence TTTTGTTTGAATTTAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155626245_1155626248 11 Left 1155626245 18:27838233-27838255 CCAAGGTGATATGATTCTCTTAA No data
Right 1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG No data
1155626244_1155626248 21 Left 1155626244 18:27838223-27838245 CCAGAGTGAGCCAAGGTGATATG No data
Right 1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155626248 Original CRISPR TTTTGTTTGAATTTAGAGGA GGG Intergenic
No off target data available for this crispr