ID: 1155633107

View in Genome Browser
Species Human (GRCh38)
Location 18:27918976-27918998
Sequence ATAGTTCAGTTACCAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155633107_1155633113 28 Left 1155633107 18:27918976-27918998 CCTGGTTTTGGTAACTGAACTAT No data
Right 1155633113 18:27919027-27919049 GTTAAGATCCTACTATAAACAGG No data
1155633107_1155633112 6 Left 1155633107 18:27918976-27918998 CCTGGTTTTGGTAACTGAACTAT No data
Right 1155633112 18:27919005-27919027 CGGTAACTTTAGGGGAAGCTAGG No data
1155633107_1155633109 -4 Left 1155633107 18:27918976-27918998 CCTGGTTTTGGTAACTGAACTAT No data
Right 1155633109 18:27918995-27919017 CTATACAAGACGGTAACTTTAGG No data
1155633107_1155633111 -2 Left 1155633107 18:27918976-27918998 CCTGGTTTTGGTAACTGAACTAT No data
Right 1155633111 18:27918997-27919019 ATACAAGACGGTAACTTTAGGGG No data
1155633107_1155633110 -3 Left 1155633107 18:27918976-27918998 CCTGGTTTTGGTAACTGAACTAT No data
Right 1155633110 18:27918996-27919018 TATACAAGACGGTAACTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155633107 Original CRISPR ATAGTTCAGTTACCAAAACC AGG (reversed) Intergenic
No off target data available for this crispr