ID: 1155637583

View in Genome Browser
Species Human (GRCh38)
Location 18:27973994-27974016
Sequence CTAGTTGAAAATGTATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155637583_1155637585 14 Left 1155637583 18:27973994-27974016 CCAATAAATACATTTTCAACTAG 0: 1
1: 0
2: 3
3: 44
4: 404
Right 1155637585 18:27974031-27974053 AATTTTAGAGTCTGTTACAGCGG 0: 1
1: 0
2: 1
3: 16
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155637583 Original CRISPR CTAGTTGAAAATGTATTTAT TGG (reversed) Intronic
901143487 1:7050609-7050631 CTATTTGAACATGTCTTTGTAGG + Intronic
902068843 1:13714168-13714190 CAAGTTAAAAATGTATATTTTGG - Intronic
902073552 1:13763665-13763687 ATAATTGAAAATGTTTTTATTGG - Intronic
902297403 1:15477084-15477106 ATAGTTGTAAATTTGTTTATGGG - Intronic
902791128 1:18768993-18769015 ATATTTGAAAATGTATTTCATGG - Intergenic
904154245 1:28469752-28469774 CTTTTTTAAAATTTATTTATGGG + Intronic
904513159 1:31031303-31031325 CTGGTTGAAACTGTATTTGTAGG - Intronic
904660584 1:32081445-32081467 CTTTTTAAAAATTTATTTATTGG + Intronic
905154090 1:35958724-35958746 CTTGTTGCACAAGTATTTATTGG + Intronic
906589840 1:47014615-47014637 AAAGTTTAAAATGTGTTTATTGG - Intergenic
907879308 1:58530329-58530351 ATTTTTGAAAATATATTTATTGG - Intronic
910464199 1:87479179-87479201 ATAGGTGAAAGTCTATTTATCGG - Intergenic
911407329 1:97458901-97458923 TTCCTTGAAAATGTATTTATGGG - Intronic
911749126 1:101476080-101476102 TTGGTGGAAAATGCATTTATTGG - Intergenic
912102568 1:106229547-106229569 CTAGTTAATAATGAATTTTTCGG - Intergenic
912148742 1:106829458-106829480 TTAGTTGAACATGTATGTATGGG - Intergenic
914359021 1:146914272-146914294 ATAGGTGAAAATCTATTTATTGG - Intergenic
914494724 1:148185604-148185626 ATAGGTGAAAATCTATTTATTGG + Intergenic
916277027 1:163005987-163006009 CTTGGGGAAAATTTATTTATCGG - Intergenic
916601340 1:166296769-166296791 ATAGTTGTAAATGTTCTTATTGG + Intergenic
916856926 1:168759783-168759805 CAAGTTGAAATTTTATTTTTAGG + Intergenic
918816698 1:189194756-189194778 TTATTTTAAAATGTATTTTTGGG + Intergenic
918939276 1:190970769-190970791 ATAGTTGAAAATTCATCTATTGG - Intergenic
919113090 1:193244384-193244406 GTAGCTGAGAATGTATATATAGG + Intronic
919504132 1:198376141-198376163 CTCCTTTAAAATGTATTTAGTGG - Intergenic
919642222 1:200056838-200056860 CTAGTTAAACATGGATTTCTTGG - Intronic
920618736 1:207522891-207522913 ATACTTTAAAATGTATTTAGGGG + Intronic
921562802 1:216678768-216678790 CCAGTGGAAAATTGATTTATGGG + Intronic
921708470 1:218349866-218349888 TTAGTCAAGAATGTATTTATGGG + Intronic
924093790 1:240529659-240529681 ATCATTAAAAATGTATTTATAGG - Intronic
924354554 1:243157701-243157723 CCAGCTGAAAATGTAGTTTTTGG - Intronic
924860214 1:247912258-247912280 CTAATTTAAAATGTATTCTTTGG - Intergenic
1063062477 10:2570840-2570862 CTAGTTACATATGAATTTATGGG - Intergenic
1063933358 10:11051692-11051714 CTAGTTTAAAATGTATGCACAGG + Intronic
1064027504 10:11860314-11860336 CTCGGTGAAAATGGATTTTTGGG + Intronic
1064822615 10:19354986-19355008 CTAATTTGAAATGTATTTATAGG + Intronic
1065398387 10:25266712-25266734 CTTATTCAAAATATATTTATTGG - Intronic
1066172452 10:32864676-32864698 CTAATTTAAATTGTATTTTTTGG - Intronic
1066319854 10:34291326-34291348 CTAGTTTAAAAGGTCTTAATTGG + Intronic
1067520239 10:46994825-46994847 CTACTTGAAAATGCAGTCATAGG - Intronic
1067782708 10:49220680-49220702 GTAGTGGGAAAGGTATTTATGGG + Intergenic
1068205535 10:53846681-53846703 CTAATTGAAGATGTATATACAGG - Intronic
1068679600 10:59805377-59805399 CTAGTAGGGAAAGTATTTATTGG + Intronic
1068967740 10:62929611-62929633 TAGGTTGAAAATGAATTTATTGG - Intergenic
1068992608 10:63165282-63165304 CTAATTGATAATGTTTTTACTGG - Intergenic
1069136690 10:64775925-64775947 TTAGTTGAAAATATCTCTATTGG + Intergenic
1070423251 10:76259225-76259247 GTATTTGAAAATATATTTCTTGG + Intronic
1071047926 10:81406175-81406197 TTGATTGAAAATGTATTTATAGG - Intergenic
1071168645 10:82836473-82836495 CGAGTTGAAAATTTATACATGGG - Intronic
1072988510 10:100166024-100166046 CTTATTGAAAAAATATTTATAGG - Intronic
1073365949 10:102941068-102941090 TTAATTTAAAATGTATTTCTAGG - Intronic
1075923488 10:126232692-126232714 CCAGCTGAGCATGTATTTATTGG - Intronic
1076090561 10:127681890-127681912 CTATTTGAAAATGGGTATATGGG + Intergenic
1077597486 11:3546548-3546570 CCAGTAGAAAATGCATTTCTAGG + Intergenic
1077942593 11:6859248-6859270 CTAGAAGAAAATGTTTTCATGGG - Intergenic
1079420491 11:20282442-20282464 CTAGTTTAAAAGTTATTTAAAGG - Intergenic
1080010723 11:27456433-27456455 CCTGTTGAAGATGTTTTTATAGG - Intronic
1080137121 11:28868215-28868237 GTGTTTTAAAATGTATTTATTGG - Intergenic
1080198619 11:29641646-29641668 CTAATTTATAATATATTTATTGG - Intergenic
1082913091 11:58399560-58399582 TTAATTGAAATTGAATTTATTGG + Intergenic
1084253590 11:67922453-67922475 CCAGTAGAAAATGCATTTCTAGG + Intergenic
1084819292 11:71673473-71673495 CCAGTAGAAAATGCATTTCTAGG - Intergenic
1086221895 11:84455731-84455753 CTATTTGAAAATATATTCAAGGG + Intronic
1086822890 11:91457117-91457139 CTAATTAAAATTGTATTTATTGG - Intergenic
1087183903 11:95165654-95165676 CATTTTGAAAATCTATTTATAGG - Exonic
1087537222 11:99464464-99464486 ATAGTTTTAAATATATTTATAGG + Intronic
1088061631 11:105658952-105658974 CTAGTTGAATATCATTTTATTGG - Intronic
1088100399 11:106148160-106148182 TTTGTTCAAAATATATTTATTGG + Intergenic
1088176624 11:107059870-107059892 AGAGTTGAAAATGTACCTATTGG + Intergenic
1088183653 11:107139816-107139838 CTAATGCAAAATGTATTTAAAGG + Intergenic
1088397797 11:109387992-109388014 CTAGCTGAAAATGGCTTAATTGG - Intergenic
1088476691 11:110247407-110247429 ATAATTGTAAATGTATATATGGG - Intronic
1089028426 11:115296249-115296271 CTAATAGAAAATGTCTTTATGGG - Intronic
1089144911 11:116320321-116320343 ATAATTGAAAATGAATATATAGG + Intergenic
1089907059 11:122050906-122050928 ATAGGTGTAAATATATTTATGGG + Intergenic
1090644405 11:128756118-128756140 TTACTTGAAAATGTAGTGATAGG - Intronic
1092087170 12:5772604-5772626 CTATTTAAAAATGTATTTGTTGG + Intronic
1092423666 12:8355842-8355864 CCAGTAGAAAATGCATTTCTAGG + Intergenic
1093573325 12:20694820-20694842 CTGGTAGCAAATTTATTTATTGG + Intergenic
1093743606 12:22715114-22715136 CCACTTGAACATGTATTTGTGGG - Intergenic
1094008225 12:25778945-25778967 ATATTTAAAAATGTATTTGTTGG + Intergenic
1094531142 12:31276211-31276233 CTAGATGAATGTGTATTTAGGGG + Intergenic
1094552035 12:31462068-31462090 TTAGGTGAAAATCTGTTTATAGG + Intronic
1095120260 12:38408905-38408927 TTAGTTGAATATGTATTTTATGG + Intergenic
1095426493 12:42080398-42080420 TGTGATGAAAATGTATTTATTGG - Intergenic
1095771252 12:45960581-45960603 ATAGGTGAAAATGTATTTTGGGG - Intronic
1095795013 12:46209641-46209663 CTATTTTAAAATCTATATATTGG + Intronic
1095877158 12:47092331-47092353 CTAGTTGCATTTGTATATATTGG - Intronic
1097535414 12:60863744-60863766 CTTTCAGAAAATGTATTTATAGG + Intergenic
1097676442 12:62607278-62607300 CAAGTTGAAAATTTTTTTTTTGG + Intergenic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1098157896 12:67619169-67619191 TTAGTTAAAAATGTCTTTAAGGG + Intergenic
1099223427 12:79940660-79940682 GTCATTGAAAATGTATTGATTGG + Intergenic
1100439604 12:94604383-94604405 CTACTTGAAAATGTTTTTCTGGG + Intronic
1101171569 12:102102023-102102045 CTAGTTTAAAAAGTAGTTGTTGG - Intronic
1103501296 12:121404741-121404763 CTGGTTGATAATATATTTAATGG + Intronic
1103594872 12:122018564-122018586 CTATTTTAAAATTTATTCATAGG - Intergenic
1103686615 12:122737163-122737185 TTAGTGGCAAATGTGTTTATTGG - Intergenic
1104590222 12:130078597-130078619 TCATTTAAAAATGTATTTATAGG + Intergenic
1104700443 12:130899311-130899333 CTTTTTGAAAATGCATTTCTAGG + Intergenic
1107349923 13:39503056-39503078 GTAATTGAAAATGCATTTATTGG - Intronic
1108112527 13:47091241-47091263 CAAGATGAAAATGTTTTTCTGGG + Intergenic
1108279116 13:48843195-48843217 CTAGTTCAAAAAGTACTTAAAGG + Intergenic
1108301719 13:49084061-49084083 CTAGTTGATATACTATTTATAGG - Intronic
1108923650 13:55709073-55709095 TTATCTTAAAATGTATTTATTGG - Intergenic
1109581206 13:64338478-64338500 TCAGTCGAAAATGTATTAATGGG - Intergenic
1110005648 13:70264060-70264082 CTCATTGAAAATTTATATATAGG + Intergenic
1110786184 13:79529750-79529772 CTAGAGTAAAATGTATTTTTAGG + Intronic
1110790928 13:79585881-79585903 CTTGTTCAACAAGTATTTATTGG + Intergenic
1111305450 13:86407112-86407134 TTGGTTGAAAATGTTTTTGTTGG - Intergenic
1111366988 13:87260514-87260536 TAAGTACAAAATGTATTTATGGG + Intergenic
1111480425 13:88817043-88817065 TTATTTGAAAATATATATATGGG - Intergenic
1111675329 13:91379983-91380005 CCATTTGAAATTGTATTGATGGG + Intergenic
1112465791 13:99643412-99643434 CTGGTTGAAAATGCAGGTATTGG - Intronic
1112703472 13:102038889-102038911 CTAGTAGAAATAGTATTTATGGG - Intronic
1112902033 13:104368724-104368746 CTTGTTGAAAATGCAATTTTTGG + Intergenic
1113817391 13:113182786-113182808 CTATTAGAAAATGCATTTTTTGG - Intronic
1114303494 14:21399416-21399438 CTTCTTGAACATCTATTTATAGG + Intronic
1114413532 14:22522817-22522839 CTAGATGAAACATTATTTATGGG - Intergenic
1114625928 14:24130336-24130358 CTAGTTCAAAATTCTTTTATAGG + Intronic
1116327811 14:43554772-43554794 ATAGTTGAAAAGGTTTTTGTTGG - Intergenic
1116473796 14:45316730-45316752 AAAGTTGAAATTGTATATATTGG - Intergenic
1116722666 14:48519897-48519919 CTAGATGTAAATCTAATTATAGG - Intergenic
1116878824 14:50143414-50143436 GAGGTTGAATATGTATTTATTGG - Intronic
1118831980 14:69442008-69442030 CTACATGAAAATGTTTTTAGGGG + Intronic
1119820014 14:77607441-77607463 CAAATGGAAAATGTATTGATTGG - Intronic
1120641957 14:87025937-87025959 CTAGTCTTAAATGTATATATTGG - Intergenic
1124362463 15:29047758-29047780 TTAGTTGATAATGTTTTTCTAGG - Intronic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125863335 15:43018854-43018876 CTAATTGAAAATGAATTTTCAGG + Intronic
1125900416 15:43341536-43341558 CTATTTAAAAATGTGTATATGGG + Intronic
1126821634 15:52510284-52510306 TTATTTTAAAATGTATATATTGG - Intronic
1127251042 15:57238694-57238716 CAAGTTAAAAATATATATATTGG + Intronic
1127408534 15:58680421-58680443 CTATTTAAAAATGTGTTTATAGG - Intronic
1127826278 15:62706632-62706654 CAACTTGAAAATGTATCTTTTGG - Intronic
1127902834 15:63353867-63353889 CATGTTTAAAATATATTTATAGG + Intronic
1131407133 15:92174524-92174546 ATACATGAACATGTATTTATGGG + Intergenic
1135436508 16:22430560-22430582 CAACTTGAAAAATTATTTATTGG + Intronic
1136075495 16:27814411-27814433 TGAGTTGAAAATGTATTAAGGGG - Intronic
1138070048 16:53983922-53983944 CTATTTGAAAATGTATTTGAGGG + Intronic
1138218615 16:55228107-55228129 ATACTTGAAAAAGTATGTATAGG - Intergenic
1138905597 16:61327491-61327513 ATACTTAAAAATGTATTAATGGG - Intergenic
1139615726 16:68088833-68088855 CTATTTAAAAATATATATATTGG - Intronic
1143822009 17:9572374-9572396 GTAGTTGAATCTGTTTTTATAGG + Intronic
1146018077 17:29249521-29249543 CTAGTAGTAAATATCTTTATGGG - Intronic
1146441707 17:32902197-32902219 CTAATTTAAAATGTATTTAAAGG - Intergenic
1147492488 17:40883008-40883030 CCAGTTGAAAATGTCATTCTTGG - Intronic
1148043537 17:44727599-44727621 AAAGTTCAAAATGTAATTATGGG - Intronic
1148840599 17:50493881-50493903 CTCGTGGAAAATGTACTTCTTGG - Intergenic
1150729775 17:67682233-67682255 CTTGTTGTACATGTATTCATGGG - Intronic
1152429529 17:80240500-80240522 CCAGTTTAAAATGTTTTTCTCGG + Intronic
1153513726 18:5884899-5884921 ATAATTGAAAATAAATTTATGGG - Exonic
1154234093 18:12586694-12586716 CTAGTAGAAAATGACTTTATTGG - Intronic
1155637583 18:27973994-27974016 CTAGTTGAAAATGTATTTATTGG - Intronic
1156091232 18:33472793-33472815 TTACTTGAAAATGCTTTTATAGG + Intergenic
1156910542 18:42406804-42406826 CAGGTTGAAAATGTCTATATTGG + Intergenic
1157956668 18:52105821-52105843 CTAGTTGAACATGCATGCATAGG - Intergenic
1158129366 18:54135885-54135907 CTATTTTAAAATGTATAGATGGG - Intergenic
1158402766 18:57136036-57136058 GTAGATGAAAATGAAATTATGGG + Intergenic
1159510672 18:69395018-69395040 CTTTTTGAAAATGTATTTTAAGG - Intergenic
1159641166 18:70864624-70864646 CTAGGAGAAAATGTTTTAATGGG + Intergenic
1161831895 19:6612032-6612054 TTAGGTTAAAATGTTTTTATTGG - Intergenic
1165371551 19:35410136-35410158 ATAGATGAAAATGTATATAAAGG - Intergenic
1166555006 19:43693106-43693128 CTAATTGAAATAGTATTTACTGG + Intergenic
1166714476 19:44957934-44957956 CTAGTTGGAGCTGAATTTATAGG + Intronic
1168215683 19:54923900-54923922 GTAGTTGAGAATGAATTTCTGGG - Intronic
925192638 2:1897931-1897953 ATAGTTGAAGAGGTATTTTTAGG - Intronic
925507271 2:4582463-4582485 CTCAATGAAAATGTAGTTATTGG + Intergenic
929395706 2:41519785-41519807 TTAGGTGACAATGAATTTATTGG - Intergenic
930293326 2:49523332-49523354 TTAATTGAAAATCCATTTATAGG + Intergenic
930343766 2:50151528-50151550 CTAGTTTCTAATGTATTTATAGG + Intronic
930818570 2:55622755-55622777 CTAGTTTAAATTGGATTTTTTGG - Intergenic
930936782 2:56962761-56962783 CTATTTGTAAAGGTATTTAATGG + Intergenic
931072827 2:58673339-58673361 CCACTTGAACATGTATTAATAGG + Intergenic
931619423 2:64194915-64194937 GTGTTTGAAAATGAATTTATTGG - Intergenic
931678924 2:64726637-64726659 CTCTTTGAAAATGTATTTTAAGG + Intronic
931952573 2:67381706-67381728 CTAGTTGAAAAAGAGTTCATGGG + Intergenic
932174719 2:69589269-69589291 AAAGTTGAAAATATAATTATTGG + Intronic
933017567 2:77148438-77148460 CTAGTTGTATATCTAGTTATTGG - Intronic
933390630 2:81662312-81662334 ATTTTTGAAAATATATTTATAGG - Intergenic
933582495 2:84143419-84143441 CTAGTAGAAAAGGTAGTTTTTGG + Intergenic
933623243 2:84569033-84569055 ATTGTTGAAAACGTATTTTTAGG - Intronic
934873616 2:97892094-97892116 CAAATTAAAAATGTGTTTATGGG - Intronic
935557272 2:104523775-104523797 TAAGTAGAAAATGTCTTTATTGG + Intergenic
936829131 2:116620167-116620189 TTAGTTGAATATATATATATGGG - Intergenic
937568628 2:123329370-123329392 ATAATTGGAAATGTATTTTTTGG - Intergenic
938630439 2:133160814-133160836 CTAGATGATAATCTATTTCTAGG + Intronic
939938601 2:148322537-148322559 CTACTTTAAAATGTAATTGTAGG + Intronic
940188659 2:151014931-151014953 CAGGTTTAAAATATATTTATTGG + Intronic
940195788 2:151092590-151092612 CTTATTAAAAATGTATGTATTGG + Intergenic
940458118 2:153927866-153927888 CTAGTTAATAAAGTATTAATAGG - Intronic
940462501 2:153984331-153984353 GTATTTGAAAGTGTATTTAGGGG + Intronic
941171525 2:162143225-162143247 CTAAAAGAAAATTTATTTATTGG + Exonic
941433325 2:165437195-165437217 CTAGTTGAGAAGCTATTTAAAGG - Intergenic
941764087 2:169277360-169277382 CTAATAAAACATGTATTTATTGG + Intronic
942008975 2:171739478-171739500 ATAGTTGAAATGGTATGTATAGG - Intronic
942216357 2:173723175-173723197 ATAGTTCAACATTTATTTATGGG - Intergenic
942319034 2:174719778-174719800 CTAGTAGAAAATGTTGGTATAGG + Intergenic
942808094 2:179958982-179959004 CTATTAGGAAATGTATATATTGG - Intronic
943181710 2:184552276-184552298 TTACTTGAAAAACTATTTATAGG + Intergenic
943768749 2:191692394-191692416 ATAATTAAAAATGTATTAATAGG - Intronic
943796141 2:191997788-191997810 AAAGTTAAAAATGTATGTATAGG - Intronic
943907202 2:193514613-193514635 CTCTTTGGAAATTTATTTATGGG - Intergenic
944076458 2:195737280-195737302 CTAATTTAAAATGTGTTTGTTGG + Exonic
945077535 2:206054944-206054966 CTAATTTAAAATATATGTATAGG - Intronic
945309330 2:208292821-208292843 CTTGTAGACAATGTATTTTTGGG + Intronic
945895046 2:215472030-215472052 CTACTTGAATATCTGTTTATAGG - Intergenic
946379525 2:219335857-219335879 CTACTTGAGAATATATTGATAGG - Intergenic
946503880 2:220278649-220278671 TTTTTTAAAAATGTATTTATTGG + Intergenic
946724500 2:222648729-222648751 CTTGATGAAATTGTATGTATTGG - Exonic
947491549 2:230599753-230599775 CTAGTTGACCATGTATATATGGG - Intergenic
1169119583 20:3086979-3087001 TCAATTTAAAATGTATTTATAGG - Intergenic
1172821166 20:37735695-37735717 CATGCTGAAAATGAATTTATGGG + Intronic
1173085975 20:39918099-39918121 CTAGATGGAAATGTAATTTTGGG + Intergenic
1173699542 20:45056075-45056097 GTAGTTGAAATAGTATTTAAAGG - Intronic
1174051121 20:47768329-47768351 CTAGTTAAAGAGGAATTTATTGG - Intronic
1175016810 20:55800416-55800438 CTATCAGCAAATGTATTTATTGG - Intergenic
1177441355 21:21130782-21130804 CCAGTTGAAAATATGTTTCTGGG + Intronic
1177597160 21:23259627-23259649 TTAGTTAAAAATGTAATTAAGGG + Intergenic
1178845881 21:36173722-36173744 CTTGATGAAAATGTTTTTCTTGG - Intronic
1179512580 21:41883687-41883709 CTAGTTGCCTATGTATTTATAGG - Intergenic
1182788433 22:32928028-32928050 TAAGTTGAAAATGCATTTATTGG + Intronic
949280401 3:2340247-2340269 ATTGTTAACAATGTATTTATGGG + Intronic
950752953 3:15145334-15145356 CCAGTAGAAAATGCATTTCTAGG - Intergenic
951218106 3:20042644-20042666 TTATTTTAAAATTTATTTATTGG + Intronic
951358060 3:21692964-21692986 AAAGTAGAAAATTTATTTATTGG + Intronic
951364675 3:21766814-21766836 CTAGTTAAAATTGTATTTACTGG + Intronic
951404061 3:22272232-22272254 CAAGTTAAAAATGCATTTAAAGG - Intronic
951565094 3:24005186-24005208 CCAATTTAAAATGTATTTACAGG - Intergenic
951675300 3:25233257-25233279 CAAGTTAAAAATGCATTTAATGG - Intronic
952546572 3:34426500-34426522 CTATTTTAAAATGCATGTATAGG + Intergenic
954086805 3:48251123-48251145 CTTGATGAATATGAATTTATCGG + Intronic
954087936 3:48260781-48260803 CTTGATGAATATGAATTTATCGG + Intronic
957669433 3:83281297-83281319 CTAGGAGAAAATGTTTTTTTGGG - Intergenic
958182668 3:90081041-90081063 TTAGTTGCAAATGTATTTGGCGG + Intergenic
958431986 3:94050638-94050660 ATATTTTAAAATGTAATTATAGG - Intronic
958954061 3:100447951-100447973 CCAGTTAAAAATATATTTGTAGG - Intronic
959028421 3:101269554-101269576 CAGGTTGAAAATGCATTTACTGG - Exonic
959884579 3:111484451-111484473 CTAGAGGAAAATGTGCTTATTGG + Intronic
960100266 3:113734813-113734835 CTATCAGAACATGTATTTATAGG - Intronic
960710967 3:120527780-120527802 CTAATTGAAAATCTATTTCCTGG + Intergenic
961599616 3:128050720-128050742 CTAGTTTAAAATATTTTTATTGG - Intergenic
962358024 3:134711586-134711608 ATGTTTGAAAATGTCTTTATTGG + Intronic
962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG + Intronic
963991019 3:151653966-151653988 TTATATGAAAATGTTTTTATTGG + Intergenic
964192680 3:154023094-154023116 CTTGTAGAAAATGTATGAATTGG - Intergenic
964417411 3:156461918-156461940 CTAGTTGAAACAGCTTTTATAGG - Intronic
964628770 3:158785764-158785786 TTAATTGAAAATATATTTATGGG - Intronic
964715900 3:159721261-159721283 CTGTTTGTAAATGTATTTATTGG - Intronic
965158535 3:165098331-165098353 ATAACTGAAAATATATTTATAGG - Intergenic
965162110 3:165146971-165146993 GTAGTTGATAATGTATTAGTAGG + Intergenic
965635205 3:170773705-170773727 CTAGTAGGAAATGTGTTTGTAGG + Intronic
966321345 3:178704516-178704538 CTAGTGGCTATTGTATTTATTGG + Intronic
966754591 3:183356566-183356588 CTAAAGGAAAATCTATTTATAGG + Intronic
967386088 3:188912453-188912475 CTAGTTGTAAAGGACTTTATGGG + Intergenic
967680356 3:192355164-192355186 ATATATGCAAATGTATTTATAGG - Intronic
967804512 3:193703484-193703506 CTGGTTGACAAAGTCTTTATGGG + Intergenic
969012230 4:4075486-4075508 CCAGTAGAAAATGCATTTCTAGG + Intergenic
969801226 4:9567119-9567141 CCAGTAGAAAATGCATTTCTAGG - Intergenic
969910480 4:10440385-10440407 TAAGTTGAAAATGATTTTATTGG + Exonic
970198691 4:13578996-13579018 CTAGTTGAAGCTGAAATTATGGG + Intronic
970327557 4:14943039-14943061 TTAATTGAAATTGTAGTTATAGG + Intergenic
970570803 4:17380458-17380480 ATATTTAAAAATGTATTTTTTGG - Intergenic
970736736 4:19179266-19179288 ATAGTTGAAAATAGGTTTATGGG - Intergenic
971060293 4:22960722-22960744 TTCATTGAACATGTATTTATAGG + Intergenic
971513375 4:27455771-27455793 TTAGTTGTAATTATATTTATAGG - Intergenic
971688998 4:29808945-29808967 TTCTTTGAAAAAGTATTTATTGG + Intergenic
971712014 4:30125796-30125818 GTATTTGGAAATGTATTTCTTGG + Intergenic
971777569 4:30986680-30986702 CCGTTTGAAAATGTCTTTATTGG + Intronic
971865920 4:32171877-32171899 CTAGTTGAAAATTTACTTTATGG + Intergenic
972809156 4:42563617-42563639 CTAGGAGAAAATGTTTTCATGGG + Intronic
973038252 4:45436371-45436393 TTAATTTAAAAAGTATTTATTGG - Intergenic
974659425 4:64866490-64866512 CTACCTGAATATATATTTATTGG - Intergenic
975360690 4:73467439-73467461 ATAATTGTATATGTATTTATGGG - Intergenic
977042683 4:92034436-92034458 CTAATTGAAAACTTATTTAAAGG - Intergenic
977439519 4:97045410-97045432 CTACTTGAAAATATATTCAGAGG - Intergenic
977963462 4:103114313-103114335 CTATTTTTAAATGAATTTATTGG - Intronic
978526447 4:109671969-109671991 CTATTTGAGAAAGAATTTATAGG - Intronic
978594174 4:110358866-110358888 CTAGTTGAAAATGAAGATTTAGG - Intergenic
978638935 4:110845163-110845185 CTACATGAAAAGGTCTTTATAGG - Intergenic
979247251 4:118521949-118521971 CCAGATGAAAATGTAGTTTTTGG + Intergenic
979323519 4:119352118-119352140 ATAATTGAAATTGAATTTATTGG + Intergenic
979324895 4:119367795-119367817 CTATTTGAAAATTTATTTCATGG + Intergenic
979739936 4:124137159-124137181 CTAATTGAAACTTGATTTATAGG + Intergenic
980225425 4:129977822-129977844 CTACTTGGAGATTTATTTATGGG - Intergenic
981038838 4:140201675-140201697 CTATTTGAAAATGAAATAATAGG + Intergenic
981347463 4:143693298-143693320 CTATTTTAAAATTTATTAATTGG - Intronic
981630552 4:146814067-146814089 CTGGTTACAAATTTATTTATTGG + Intronic
981903987 4:149898639-149898661 CTACTTTAAAATATATCTATAGG - Intergenic
982215021 4:153075140-153075162 CTGTTTGAAAATGTATTTCTTGG - Intergenic
982584182 4:157216524-157216546 TTATTTGAAAATGTATTTAAAGG - Intronic
982906092 4:161074388-161074410 ATAGTTCAATATTTATTTATAGG - Intergenic
982907502 4:161093542-161093564 CTATTTTGAAATATATTTATGGG + Intergenic
983241353 4:165236786-165236808 ATAATTGAAATTGAATTTATTGG + Intronic
983242800 4:165252813-165252835 CTATTTGAAAATTTATTTCATGG + Intronic
983731761 4:171003069-171003091 CTTTTTGAAACTGGATTTATGGG - Intergenic
984032633 4:174623577-174623599 CTATTTTAAAATATATGTATTGG - Intergenic
984042207 4:174748971-174748993 CTACTTGCAAGTGGATTTATGGG + Intronic
984234689 4:177142068-177142090 CTAGGAGAAAATGTTTTTGTGGG + Intergenic
984439798 4:179752321-179752343 TTTGTTGAAAATGAATTTCTGGG - Intergenic
984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG + Intronic
985120194 4:186632214-186632236 CTAATTAAAAATATAATTATTGG + Intronic
985925550 5:3013209-3013231 CTTGTTGCAAATGCATTTATTGG - Intergenic
986111937 5:4728018-4728040 GGAGTTGAAAATGTGTTTTTGGG - Intergenic
987461266 5:18214006-18214028 TGAGTTGAAAATGGATGTATAGG - Intergenic
987516236 5:18913989-18914011 ACAATTGAAAAGGTATTTATAGG - Intergenic
987644013 5:20646999-20647021 TTAGTTGAAAATGTAGTGAATGG - Intergenic
987698911 5:21369184-21369206 CTAGTTGAATATGTAATCATAGG + Intergenic
988753742 5:34222287-34222309 CTAGTTGAATATGTAATCATAGG - Intergenic
989989413 5:50743328-50743350 CAATTTGAAAATGTTTTTAGAGG + Intronic
990331869 5:54735656-54735678 CTAGTTGAAAATTAATCAATAGG - Intergenic
991269432 5:64762408-64762430 GTAATTGAAATTGTCTTTATAGG - Intronic
991707842 5:69376423-69376445 CTAGTTGGAAATGTATTTCAAGG - Intronic
993416230 5:87636170-87636192 TGACTTGAAAACGTATTTATAGG - Intergenic
993426225 5:87767631-87767653 CTGGATGAAAAGGTATTTTTTGG - Intergenic
993738803 5:91510332-91510354 CTAGATTAAAATGTATTAAATGG - Intergenic
993829029 5:92730184-92730206 TTAGATTAAAATGTGTTTATAGG - Intergenic
994293684 5:98062948-98062970 ATAATTATAAATGTATTTATTGG + Intergenic
994898597 5:105740160-105740182 TTAGTTTTCAATGTATTTATTGG + Intergenic
994912932 5:105936464-105936486 ATGCTTGAAAATGTATTTCTTGG - Intergenic
994983982 5:106912085-106912107 CTAGTGAATAATTTATTTATTGG + Intergenic
995945247 5:117637320-117637342 CTATTGGAAAATGTATGTCTGGG - Intergenic
996886076 5:128354919-128354941 CTAGTTGATAATGAAATTCTAGG - Intronic
997151875 5:131505443-131505465 AAAGTTGAAAATTTGTTTATGGG - Exonic
997156476 5:131565684-131565706 TCAGTTGAACATGTATTTATGGG - Intronic
998655646 5:144176292-144176314 ATTGTGGAAAATATATTTATTGG + Intronic
999062304 5:148649008-148649030 GTATTAGTAAATGTATTTATTGG - Intronic
1000805631 5:165787615-165787637 CTGGTTGCATATGAATTTATTGG + Intergenic
1003391823 6:5720153-5720175 CTAGTTCGCAATGTATTTAATGG - Intronic
1004974179 6:20946528-20946550 TAAGTTGAAAATGCATTTAAAGG - Intronic
1004974257 6:20947288-20947310 TAAGTTGAAAATGCATTTAAAGG + Intronic
1005551912 6:26929119-26929141 CTAGTTGAACATGTAATCATAGG - Intergenic
1006960246 6:37922171-37922193 CTAGATGAAAAAGTATATTTTGG - Intronic
1007162924 6:39807107-39807129 CTGGTTGATAATGGATATATGGG - Intronic
1007355311 6:41310744-41310766 CTAGTTCAAAATGTATTTGTGGG - Intergenic
1008387267 6:50905955-50905977 CTAGTTTAAAATGCCTTTTTAGG - Intergenic
1008598859 6:53069195-53069217 CTAGGTTAAAATGTATTGTTAGG - Intronic
1008734255 6:54523350-54523372 CTTTTTAAAAATTTATTTATTGG + Intergenic
1008783762 6:55140538-55140560 CTAGCTGAAAAAGTCTTTTTGGG - Intronic
1008891573 6:56498646-56498668 ATATTTGAAAATGAATATATAGG - Intronic
1009285314 6:61808429-61808451 CTAGTAATAAATGTATTTAATGG - Intronic
1009537892 6:64913374-64913396 GGGGTTGAAAATCTATTTATTGG - Intronic
1010022085 6:71172117-71172139 CTATTTAAAAATGTATTGTTGGG + Intergenic
1010264195 6:73850016-73850038 AGAGTGGAAAATGTATTTAAAGG - Intergenic
1010474273 6:76266559-76266581 CTATTTGATAATATATTTAGAGG + Intergenic
1011025934 6:82869100-82869122 CTAGTTGCAGAAGTATTTAATGG - Intergenic
1011228673 6:85135833-85135855 TTATTTGCAAATGTTTTTATTGG - Intergenic
1011416673 6:87127443-87127465 ATAGTTGAAAAAGTATTACTTGG + Intergenic
1013778613 6:113706012-113706034 CTAGTTTAAAATTTTTTTCTTGG - Intergenic
1014090659 6:117400410-117400432 CTTGTTCAAAATATATTCATGGG - Intronic
1014888279 6:126809326-126809348 GGACTTGAAAATATATTTATTGG + Intergenic
1015501609 6:133939748-133939770 GTACTTTAAAATGTATTTGTGGG + Intergenic
1015992619 6:138962554-138962576 CTATTGGAATATGTATTTAAGGG - Intronic
1017229631 6:152059040-152059062 CTAGTTGAAAAAATATTAATTGG + Intronic
1017698570 6:157044224-157044246 CTATTTGAAATTATATTTACGGG - Intronic
1017711924 6:157177650-157177672 CTTGAGGAAAATGTACTTATAGG + Intronic
1018140875 6:160835062-160835084 CAAGTTTAAAATGCATTTGTTGG - Intergenic
1020946964 7:14623492-14623514 CTATTTAAAAATGTCTTTCTAGG - Intronic
1022745453 7:33167013-33167035 CAAATTAAAAATGTATTAATTGG - Intronic
1023341402 7:39224617-39224639 AAACTTGAAAATTTATTTATTGG + Intronic
1023499723 7:40834505-40834527 CTAATTGCAAATAAATTTATTGG + Intronic
1023558971 7:41452638-41452660 CTATTTTAAAATATATTTATTGG + Intergenic
1023708533 7:42967578-42967600 CTTGTGGAAAATTTAATTATTGG + Intergenic
1024793691 7:52996580-52996602 CTACTTGAAAAAGTGTTTAATGG + Intergenic
1024861750 7:53852435-53852457 TTAGTTGAAAATCTTTGTATGGG + Intergenic
1024867142 7:53916351-53916373 CTTGTTGAAAAATTATTTATTGG + Intergenic
1026732137 7:72921250-72921272 TTGGTTGAACATTTATTTATGGG - Intronic
1027848082 7:83411033-83411055 ATAATTGAAAATATTTTTATGGG + Intronic
1027918984 7:84366299-84366321 TTAGTTGAAAATGTATTTCGTGG - Intronic
1028276346 7:88862543-88862565 CTAGTTGAAAATTTATTCCACGG + Intronic
1030236885 7:107273399-107273421 CTATTTGAAATTATATTTCTGGG - Intronic
1030455647 7:109770880-109770902 CTAGTATAATATGTAGTTATTGG + Intergenic
1030635074 7:111939213-111939235 ATTGTTTAAAATCTATTTATGGG + Intronic
1030645769 7:112059922-112059944 CTACTTTAAAATATTTTTATTGG - Intronic
1030655062 7:112158340-112158362 TTTGTTCAAAAAGTATTTATTGG - Intronic
1030831101 7:114222497-114222519 GTATTTGTATATGTATTTATTGG + Intronic
1030848471 7:114453611-114453633 CTAGTTGTCAATGTATCTCTTGG - Intronic
1030968283 7:116021472-116021494 AGAGCTGACAATGTATTTATAGG - Intronic
1031486040 7:122326046-122326068 CTACTTTAAAATGTAATTTTAGG - Intronic
1031900468 7:127403804-127403826 CTATTTGAATAGGTAATTATTGG + Intronic
1033872718 7:145776816-145776838 CTAGTTGAGAAAGAATTTAAGGG - Intergenic
1034725926 7:153335105-153335127 CTGATTGAAAATGTATTAAGTGG - Intergenic
1036247049 8:7126792-7126814 CCAGTAGAAAATGCATTTCTAGG - Intergenic
1036253744 8:7187577-7187599 CCAGTAGAAAATGCATTTCTAGG + Intergenic
1036363750 8:8099903-8099925 CCAGTAGAAAATGCATTTCTAGG - Intergenic
1036681205 8:10875634-10875656 CAAGGGGAATATGTATTTATAGG - Intergenic
1037289042 8:17331718-17331740 CTATTTGATAACGTGTTTATTGG - Intronic
1038074285 8:24052781-24052803 GTAGTTGTATATATATTTATTGG + Intergenic
1039015808 8:33147402-33147424 TAAATTGAAAATGTATTTGTTGG + Intergenic
1039225714 8:35385856-35385878 CTAGTTGAAATTGTTTTTCATGG + Intronic
1039705454 8:40002084-40002106 ATACATAAAAATGTATTTATGGG - Intronic
1040627953 8:49173854-49173876 GTAGTTGAAAATGCAGTTTTAGG - Intergenic
1041272654 8:56124210-56124232 CTGGTTGAAATAGTATTTTTAGG - Intergenic
1042586866 8:70349310-70349332 ATATTTGAAAATTTATATATGGG + Intronic
1043238594 8:77901377-77901399 ATAGTTATATATGTATTTATGGG + Intergenic
1043265839 8:78266821-78266843 CTAGAAGAAAATGGTTTTATGGG + Intergenic
1043271360 8:78338457-78338479 ATAGTTTAAAATGTGTTTATTGG + Intergenic
1043515891 8:80994290-80994312 TCATTTGAAAATGCATTTATTGG - Intronic
1044480342 8:92679915-92679937 CTATTTTAAAATGCATTGATAGG + Intergenic
1044503190 8:92986428-92986450 CAATTAGCAAATGTATTTATAGG + Intronic
1045285475 8:100787619-100787641 TAAGTTAAAAATGCATTTATTGG - Intergenic
1046156664 8:110299807-110299829 ATAGTTTAAAATGTGTTTCTGGG + Intergenic
1046341801 8:112868704-112868726 TTAGTTGACTATATATTTATGGG - Intronic
1046492369 8:114968981-114969003 TTGGTTGAAAATGTGTTTATAGG + Intergenic
1046857256 8:119047090-119047112 CTATTCAAAAATGTATTTTTTGG + Intronic
1046978686 8:120312640-120312662 GTAGTTGAAAATATATTTATAGG - Intronic
1050066968 9:1770294-1770316 TTATTTGAAAATTTATATATGGG - Intergenic
1050190391 9:3019171-3019193 CAAGTTTAAGATGTATTTATGGG + Intergenic
1050739996 9:8808836-8808858 CTCTTTGAAAATGTATATTTCGG - Intronic
1050875890 9:10635710-10635732 CTTGTTGAAAATATAATTATTGG + Intergenic
1051346872 9:16159566-16159588 ATAGTTGTAACTGTGTTTATAGG + Intergenic
1051536747 9:18167657-18167679 TTACTTGAGAATGTATGTATTGG - Intergenic
1051749577 9:20327190-20327212 CAAGTTCAAAATGTCTTTTTGGG + Intergenic
1052153406 9:25149927-25149949 CTATATGAAAATGTACTTACAGG - Intergenic
1052635663 9:31100976-31100998 CTTTTTAAAAATGTATTTCTAGG + Intergenic
1052797616 9:32937979-32938001 TAAGTTGAAAATGTATTGGTAGG - Intergenic
1053239443 9:36484864-36484886 CTATCTAAAAATGTATGTATTGG + Intronic
1055164966 9:73180306-73180328 GTAGTAGAAAGTTTATTTATAGG + Intergenic
1055619819 9:78113223-78113245 CCAGTTGAAAATGGGTTGATAGG + Intergenic
1055952399 9:81742387-81742409 TTATTTAAAAATGTATTTAAGGG - Intergenic
1055982372 9:82016886-82016908 ATAGTTGAAAAAAAATTTATAGG - Intergenic
1056448853 9:86695181-86695203 CTATTTAAAAATATATGTATAGG - Intergenic
1057003687 9:91536453-91536475 CCAGTTGAAAATGCATTGAGGGG + Intergenic
1058179478 9:101779315-101779337 CTAGGTGAACATGAATTTTTTGG + Intergenic
1058958642 9:109972167-109972189 CCTGTTGAAGTTGTATTTATAGG - Intronic
1060246285 9:121949219-121949241 CTAATTTAAAATGTATTGAGTGG - Intronic
1185713084 X:2319760-2319782 GCAGTTGAAAATCTATGTATAGG - Intronic
1185845102 X:3430591-3430613 AGGGTTGAAAATGTATTTATTGG - Intergenic
1187546105 X:20253856-20253878 CTAGGTGAAAATGAATTAAATGG - Intronic
1187552257 X:20317841-20317863 CTTGTTGAAAATGCATTTCCAGG + Intergenic
1187692984 X:21890161-21890183 ATATTTTAAAATGTGTTTATTGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189577822 X:42374332-42374354 CTGGTTGAAAAAGTATTTTGAGG + Intergenic
1190394922 X:49972219-49972241 ATAATTGAGTATGTATTTATTGG + Intronic
1191061451 X:56301907-56301929 ATTCTTGAAAATTTATTTATAGG + Intergenic
1192072386 X:67954787-67954809 GTAGTTAAAAATGTTTTTAGTGG - Intergenic
1192137502 X:68617737-68617759 CTATTTAAAAATGTATAAATTGG - Intergenic
1192677708 X:73215754-73215776 CTATTTGATAATGTATTTATAGG + Intergenic
1193501458 X:82280214-82280236 CTAATTCAAAGTTTATTTATAGG + Intergenic
1194029299 X:88791082-88791104 ATAGCTGAAAATGTATGTAATGG - Intergenic
1194338950 X:92685524-92685546 CTAGTAGAAAAAGTAATAATTGG - Intergenic
1194544995 X:95222452-95222474 TTTGTTGATAATGTATTCATGGG - Intergenic
1194675322 X:96787305-96787327 TTAGTTCAAAATCCATTTATTGG - Intronic
1194808654 X:98363068-98363090 CTAGTTGAAAATATATTGCTTGG + Intergenic
1194897652 X:99465261-99465283 TTAGTTGACAATATATGTATAGG + Intergenic
1195545194 X:106105988-106106010 CTAGGAGAAAATGGTTTTATGGG + Intergenic
1197558665 X:127990854-127990876 TCAGATGGAAATGTATTTATTGG + Intergenic
1198237610 X:134750026-134750048 ATAGTATAAAATGTATTTAGAGG - Intronic
1198929995 X:141845792-141845814 TTCGTTGAAAAAGGATTTATGGG + Intronic
1199004534 X:142679798-142679820 CTTGTTCAATATATATTTATGGG - Intergenic
1199865382 X:151843594-151843616 TTAGTTGACAATGTTATTATAGG - Intergenic
1200647343 Y:5802303-5802325 CTAGTAGAAAAAGTAATAATTGG - Intergenic