ID: 1155638746

View in Genome Browser
Species Human (GRCh38)
Location 18:27986720-27986742
Sequence AACTTCTATGAGGAATATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155638743_1155638746 8 Left 1155638743 18:27986689-27986711 CCTGGGGAGGGAATAAGGAGGAA 0: 1
1: 0
2: 1
3: 48
4: 440
Right 1155638746 18:27986720-27986742 AACTTCTATGAGGAATATGATGG 0: 1
1: 0
2: 0
3: 16
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155638746 Original CRISPR AACTTCTATGAGGAATATGA TGG Intronic
900841263 1:5050387-5050409 GACTTCCAGGAGGAATAGGAGGG - Intergenic
904654643 1:32035171-32035193 AACCCTTCTGAGGAATATGAGGG - Intronic
905997698 1:42395873-42395895 TACTACTATTAGAAATATGATGG + Intronic
907618228 1:55947213-55947235 GACTTCTATGTGCAATATAAAGG - Intergenic
908032311 1:60014638-60014660 CTCTTCTATGAGGGTTATGAAGG + Intronic
908199638 1:61781022-61781044 AACTTCTAAGAGTATTTTGAAGG - Intronic
908439386 1:64138488-64138510 ATGTGCTATGAGGAATGTGAAGG + Intronic
908469099 1:64424642-64424664 AACTCCTATTAGGCATATGTTGG - Intergenic
908485910 1:64593059-64593081 AACTTTTAGGAGAAAAATGATGG + Intronic
909595027 1:77397137-77397159 AACTTCTTTGAAGAAGATGAGGG - Intronic
910786703 1:91006732-91006754 AATTTCTAGGATGATTATGAAGG - Intronic
911703140 1:100978782-100978804 ATCTTCCATAAAGAATATGATGG - Exonic
912409827 1:109473064-109473086 AACTTCTAAGAGGAATCAGATGG + Intronic
917097830 1:171417408-171417430 AACTGCTAAGAAGAAAATGAAGG + Intergenic
918796991 1:188912798-188912820 AACTTCTACAAGAAAAATGAAGG - Intergenic
918840470 1:189529875-189529897 AACTTATTTGTGGAATATAAGGG + Intergenic
919034688 1:192291672-192291694 AACTTCTTGTAGGAAGATGATGG + Intergenic
919650256 1:200142007-200142029 AACTCCTATCAGGCATATGTTGG + Intronic
920613002 1:207460201-207460223 AGATTCTATAAGGAATATCAGGG - Intronic
921766232 1:218975398-218975420 AACTTCATGGAGGAATATGGAGG + Intergenic
922281975 1:224134419-224134441 AACTTCTCTAAAGAATATTAGGG - Intronic
922860974 1:228816039-228816061 AAGTTTTGTGAGGATTATGAGGG + Intergenic
924642528 1:245848040-245848062 AACTTCCTTGTGGAATAAGATGG - Intronic
1064638677 10:17393854-17393876 AAATTCTATCAGGATTAAGAGGG - Intronic
1064779393 10:18818302-18818324 AAATTCTATGTGGAATATTATGG - Intergenic
1064872127 10:19949464-19949486 AACTACTAATAGGAATAGGAGGG + Intronic
1064888132 10:20135461-20135483 AATTTCTTTGAGGAACAAGATGG + Intronic
1068000849 10:51332336-51332358 AAGTTCTATAAGGAATAGCATGG - Intronic
1069128844 10:64673394-64673416 ACTTTCTATAAGAAATATGAAGG + Intergenic
1069359437 10:67624923-67624945 TACTTCTGTGAGGAAAAGGATGG - Intronic
1069630397 10:69894017-69894039 GACTTCTCCAAGGAATATGAGGG - Intronic
1069689819 10:70343080-70343102 AAATTCTGTGAGGCAGATGAGGG - Intronic
1071209519 10:83322684-83322706 AATTTCTATGAAGAATGTTATGG - Intergenic
1074791087 10:116888359-116888381 AACAACTATGAGTAATATTAAGG + Intronic
1077108021 11:850270-850292 CAGTTCTAGGAGGAAGATGAAGG - Exonic
1084354707 11:68630113-68630135 AACTTCCAGGAGGAAGAGGAGGG - Intergenic
1085730624 11:78995472-78995494 ACCTTCTACCAGGAATTTGAAGG + Intronic
1086238382 11:84659697-84659719 ACCAACTATGAGGTATATGAGGG + Intronic
1088345557 11:108820406-108820428 ACCTCCTATGTGGAATAAGAGGG - Intronic
1088515660 11:110630381-110630403 AAATTCAATGAAGAATGTGATGG - Intronic
1088940844 11:114454096-114454118 AGCTTTAATGAGGAATCTGATGG + Intergenic
1089801759 11:121036653-121036675 AATTTTGATGAGAAATATGAGGG - Intronic
1091736929 12:2930265-2930287 AACTTCGATGAGGAGACTGATGG + Exonic
1092386606 12:8040335-8040357 AACTTTTATAAGGTATATTAGGG + Intronic
1092602065 12:10078075-10078097 AAAATCTAGGAGAAATATGATGG - Intronic
1093010035 12:14097394-14097416 AACATCTCAGAGAAATATGAGGG + Intergenic
1094092732 12:26669318-26669340 AACTTTTATGAGATATATGTTGG - Intronic
1094256076 12:28428175-28428197 TATTTCTATGAAGTATATGAGGG - Intronic
1094762907 12:33555996-33556018 TAACTCTATGAGCAATATGATGG - Intergenic
1096521145 12:52185478-52185500 CATCTCTATGAGGAATATCAGGG - Exonic
1096915058 12:55022691-55022713 AACTTCCATCTTGAATATGATGG + Intronic
1097366820 12:58724760-58724782 AACTTAGATGTGGAAAATGAAGG + Intronic
1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG + Intronic
1099528703 12:83747214-83747236 AACTTTTATGTGGGATATGAGGG + Intergenic
1099741672 12:86644474-86644496 AACTTCCATCAGCAATATGGTGG - Intronic
1100011602 12:89960577-89960599 ATCTTCTATGAGAAATATTTTGG + Intergenic
1100287245 12:93178772-93178794 ATGTTTTATTAGGAATATGAAGG + Intergenic
1101368770 12:104103977-104103999 ATCTGTTATGAGGAAAATGAGGG - Exonic
1102143697 12:110637936-110637958 ACCTATTATGAGGAATGTGATGG + Intronic
1102503092 12:113366275-113366297 AATTTCTATTAAGAAAATGAGGG - Intronic
1105471484 13:20698941-20698963 AAGTTGTAAGAAGAATATGAAGG - Intergenic
1107284665 13:38777828-38777850 AACTTCTAACAGAAATATGTAGG - Intronic
1108726105 13:53183252-53183274 AACTTCAATTAGGAAAATGGTGG - Intergenic
1108960054 13:56215322-56215344 TACTTCTATAAGGTATATAAAGG + Intergenic
1110703121 13:78572525-78572547 AACTTCTTTGAGAGATCTGAAGG - Intergenic
1111482668 13:88851724-88851746 AACTTCCATGAGGCATATATTGG - Intergenic
1111724552 13:91989338-91989360 AACATGTAAGATGAATATGATGG + Intronic
1112138820 13:96614645-96614667 AAATTCTATGAGGCTTTTGAAGG + Intronic
1114606371 14:24001141-24001163 AACTTCTTTGGGTAATAGGAGGG - Intronic
1118032940 14:61836191-61836213 AATTTCTATGATGTGTATGAAGG - Intergenic
1119522482 14:75296111-75296133 AACTTCTAGGCTGAATATGAAGG + Intergenic
1120734072 14:88034002-88034024 AACTTGTATTAGGAATATTTGGG - Intergenic
1125308524 15:38350971-38350993 AACTGCAATGAGGGCTATGATGG - Intronic
1126242314 15:46459474-46459496 AACTTCTATGATTAGTCTGACGG - Intergenic
1127341232 15:58046487-58046509 TTGTTCTATGAGGAAGATGAAGG - Intronic
1130844019 15:87727195-87727217 AAATTCAATGAGGACTATGCTGG + Intergenic
1133766329 16:8840655-8840677 AACTTCCAGGAGGAAGAGGAGGG + Intronic
1133955071 16:10435501-10435523 AACATTTATGAGGTATTTGATGG + Intronic
1136252624 16:29015907-29015929 AACCTCTATGAAAAATAAGATGG - Intergenic
1137085476 16:36116503-36116525 AATTTCAATGATGTATATGATGG + Intergenic
1138949298 16:61891605-61891627 AACTTCTATTAGAGATATGTAGG - Intronic
1141293394 16:82742652-82742674 AACTGCAATGAGGACTATAAAGG + Intronic
1141926342 16:87172762-87172784 ACTTTCTGTGAGGAATCTGAGGG - Intronic
1143694041 17:8597222-8597244 AACTTCTATCAGGAAGATATGGG + Intronic
1146396741 17:32473848-32473870 TACTTCTATGAGGCATTTGAGGG + Exonic
1149970116 17:61209632-61209654 TTGTTCTTTGAGGAATATGAGGG + Intronic
1149985797 17:61345889-61345911 AAGTTTTATGATGAATATGTGGG + Intronic
1150219628 17:63488829-63488851 CACCTCTTTGAGGAAAATGAAGG - Intronic
1152115350 17:78383186-78383208 AACTTCTCTGAGTTATAAGAGGG + Intronic
1153265973 18:3269782-3269804 AACATCTAAGAGGAAAATGGAGG + Intronic
1153666661 18:7372405-7372427 AAAGTCTTTTAGGAATATGAAGG + Intergenic
1155518065 18:26642634-26642656 AACTTCACTGAGAAATATGTTGG + Intronic
1155638746 18:27986720-27986742 AACTTCTATGAGGAATATGATGG + Intronic
1156205810 18:34884332-34884354 ACCTTCTATGAGTAAAATGAAGG + Intronic
1157027473 18:43862886-43862908 AACTTGTATGAGGAGCCTGATGG - Intergenic
1158033584 18:52997267-52997289 AAATTCTAAGTAGAATATGAAGG - Intronic
1158646456 18:59252740-59252762 AAATTCTATGTGGAATTTTAAGG - Intergenic
1159608180 18:70496700-70496722 AATATCTATTATGAATATGAAGG - Intergenic
1163899675 19:20090420-20090442 GACTTCTAGGAGGAAGAGGAGGG + Intronic
1166786171 19:45368694-45368716 AACTTCTATGAGAAGCAGGAGGG - Exonic
1167850327 19:52196255-52196277 ATTTTCTATCAGGAATGTGACGG + Intronic
925477396 2:4232618-4232640 AACTTGTGTGAAGAATGTGAAGG - Intergenic
926871388 2:17421780-17421802 AATTTATATGAGGATGATGATGG - Intergenic
928066000 2:28165212-28165234 AGTTTCTTTGAGGAATGTGAAGG + Intronic
928796001 2:35020028-35020050 CTCATGTATGAGGAATATGAAGG + Intergenic
930659305 2:54037888-54037910 AAATTCTTTCAGGAATGTGAAGG + Intronic
933505305 2:83169874-83169896 AAGTGCTATGAAGAAAATGAAGG + Intergenic
938706167 2:133929383-133929405 AACTTCTTTGAGAAATGAGATGG - Intergenic
939171918 2:138705947-138705969 CATTTTTATGGGGAATATGAAGG - Intronic
941584020 2:167334302-167334324 ATCTTCTAAGAGGAATAAGTTGG + Intergenic
941699529 2:168589115-168589137 AGCTTCTATGAAAAATATGGTGG - Intronic
941785283 2:169491226-169491248 AAGTTCTAAATGGAATATGAAGG + Intronic
943042779 2:182823120-182823142 AAGTTCTATTAGGAATATTTAGG - Intergenic
1169407964 20:5340782-5340804 GACTACTATGAGCAATATTATGG + Intergenic
1170879820 20:20286928-20286950 AACTTCTGTGAGGATGCTGAAGG + Intronic
1172818603 20:37711600-37711622 AATTTCAAATAGGAATATGAAGG + Intronic
1177536597 21:22436319-22436341 AGGTTTTATGAGGAATTTGAGGG + Intergenic
1178256932 21:31061852-31061874 CAGTTCTATGTGGAATTTGAAGG - Intergenic
1181412892 22:22737258-22737280 AACATCTGTGAGGTATATGTGGG - Intronic
1184317622 22:43709019-43709041 GATATCTATGAAGAATATGATGG - Intronic
949158583 3:854524-854546 AAATTCCATGAGGAAGAAGAAGG + Intergenic
951956777 3:28264672-28264694 AAGTTGTATGAGGAATGTGCAGG - Intronic
954516518 3:51182603-51182625 AACTTCAAGGTGAAATATGAAGG - Intronic
956728953 3:72178961-72178983 AACTGCTGTGAGTAAGATGAAGG + Intergenic
957454774 3:80427371-80427393 TACTTCTATGAAGAATGTCAAGG + Intergenic
957592507 3:82218099-82218121 AACTTCTAAGAGAAAATTGATGG + Intergenic
958103669 3:89046550-89046572 AACTTTTATCAGGAAGCTGAAGG + Intergenic
959683479 3:109122120-109122142 AACTTCTGGGAGGAATAGAAGGG + Intergenic
961355578 3:126337871-126337893 AAGTTCCAGGAGGAAGATGAAGG + Intergenic
963370910 3:144398769-144398791 AATTTCTATGAAGAATGTCATGG + Intergenic
965489078 3:169314840-169314862 AATTTCTATGAGGAAGCTGGAGG + Intronic
965495024 3:169387912-169387934 AACTGCAATGAGGAACATAATGG - Intronic
971386640 4:26146656-26146678 ATCTTCTTTGAGGAGTATGAGGG + Intergenic
971800863 4:31288716-31288738 AAGTTTTATGAGGAAATTGATGG - Intergenic
972800508 4:42470691-42470713 AACTTTTTAGAAGAATATGAAGG + Intronic
973263168 4:48185752-48185774 AATCTCTATAAGAAATATGAAGG + Intronic
973300817 4:48581873-48581895 GATTTCTATGTGGAAAATGAGGG + Intronic
976374039 4:84324216-84324238 AACTTCTATGATGATTATTTTGG - Intergenic
978870038 4:113564854-113564876 ATATTAGATGAGGAATATGATGG + Intronic
978994088 4:115128529-115128551 AACCTCTATGAAAAATATTATGG - Intergenic
979575815 4:122291086-122291108 AAGGTCTATGAAGAATAAGATGG + Intronic
979689231 4:123543037-123543059 AATTACTAAGAGGAATATCAGGG - Intergenic
981232307 4:142370898-142370920 TACTTCTATGAGGAATGTCTTGG - Intronic
982320957 4:154077219-154077241 GACTTCTTTGAGGAATTTTAAGG - Intergenic
982605525 4:157512140-157512162 CACTTCTATGAGGAAAGGGAGGG + Intergenic
983748088 4:171226501-171226523 GAATTTTATGAGGAATATCAAGG + Intergenic
984336418 4:178397732-178397754 AAATGCTAAGAGGAATATGAGGG + Intergenic
984402453 4:179284468-179284490 ATCTACTATGTTGAATATGAAGG + Intergenic
985355632 4:189116367-189116389 AACCTCACTGAGGAATCTGAAGG + Intergenic
986033457 5:3915199-3915221 AACTTCAAGAAAGAATATGAGGG + Intergenic
986909681 5:12539716-12539738 AACTTCTATGAAAAATAGTATGG + Intergenic
989339756 5:40360288-40360310 AACATCTATAAAGATTATGATGG + Intergenic
993331808 5:86609757-86609779 AACTTCTATGAAAAACATTATGG - Intergenic
996955181 5:129175017-129175039 AACTTCTTTCAGGAATAAGTTGG + Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
997770095 5:136545775-136545797 TATTTCTATGAAGAATATCATGG + Intergenic
999042457 5:148429758-148429780 AACTTCAATGGCTAATATGAAGG - Intronic
999911598 5:156207503-156207525 CACTTCCATAGGGAATATGAAGG + Intronic
1000192742 5:158927263-158927285 AACATCGATGATGATTATGATGG - Intronic
1000905131 5:166957234-166957256 AACTTCTATGAAGAAAATAAAGG + Intergenic
1001815857 5:174668908-174668930 AACTTCTATGAAGCATATTTAGG + Intergenic
1202771341 5_GL000208v1_random:1017-1039 GAACTCTATGAGGAATATGTTGG - Intergenic
1004290098 6:14358913-14358935 AATTTCTAGGAGAAATATCAAGG - Intergenic
1006596608 6:35197550-35197572 AAATTCTTTAAGGAATACGAGGG + Intergenic
1008668448 6:53741758-53741780 AACTTCTATGGGGAATAAGCAGG - Intergenic
1010237849 6:73589962-73589984 TACTTTTAAGAGAAATATGAAGG + Intergenic
1010586214 6:77660725-77660747 AACTTCCAGGAGGAAGAGGAGGG + Intergenic
1010802448 6:80192758-80192780 AAATTTTATAAGAAATATGAAGG + Intronic
1012832772 6:104226636-104226658 AACTGCTTTGAGGAAAATAAAGG - Intergenic
1013402376 6:109811368-109811390 ACCTTCTATCAGCAATGTGATGG + Intronic
1014169178 6:118259892-118259914 AGCTTTTATGAGGAACATGTGGG - Intronic
1014493850 6:122094728-122094750 AACTTTTATGAGTAAGATGCAGG - Intergenic
1014628712 6:123762577-123762599 AAGTTTTAGGAGGAAAATGAGGG + Intergenic
1014709620 6:124791467-124791489 ATCTTGTCTGAGGAATAGGAAGG - Intronic
1014712617 6:124825258-124825280 AACTTAAAGCAGGAATATGAGGG - Exonic
1014903452 6:126997684-126997706 AAATTCTCTGATAAATATGAGGG + Intergenic
1014908383 6:127058863-127058885 AAGTTCTATGCTGAAAATGATGG - Intergenic
1014909788 6:127078051-127078073 ACCTTCTATGAGGAACAGGATGG - Intergenic
1015170072 6:130242596-130242618 GACCTCTCTGAGGAATAAGAAGG + Intronic
1015262684 6:131256485-131256507 AATTTCCATGAGGAATAGCAAGG + Intronic
1015306269 6:131712120-131712142 AACATCTATGGTGAATATAAAGG - Intronic
1016817049 6:148312763-148312785 AACTTATATAATGAATATAAAGG - Intronic
1017285588 6:152672307-152672329 AATTTCTAAGAGCAATATTATGG + Intergenic
1021007875 7:15422568-15422590 AACTTCAAAGAGAAATGTGAGGG - Intronic
1021919601 7:25471364-25471386 AATTTGTATTAGGAATATGAGGG + Intergenic
1022341433 7:29472236-29472258 AGCTTCTATGGGGATTTTGAGGG - Intronic
1022373270 7:29789802-29789824 AACTTCCAGGAGGAAGAGGAGGG - Intergenic
1022577254 7:31509517-31509539 AACTTCTCTGAGGAATAATCAGG - Intergenic
1022597887 7:31730153-31730175 AGCTACCAAGAGGAATATGATGG - Intergenic
1023226685 7:37977095-37977117 AACTTGGATGAGGAAATTGATGG + Intronic
1023508792 7:40928271-40928293 AACTTCTATTAGACATATGTTGG + Intergenic
1023900933 7:44478233-44478255 CTCTTCTCTGAGGAATAAGATGG + Intronic
1024295382 7:47837573-47837595 AAAGTCTCTTAGGAATATGAAGG - Intronic
1024618804 7:51139376-51139398 AACTTCTAGGAGGACTGGGATGG - Intronic
1025273174 7:57545221-57545243 AAATTCTGTGAATAATATGATGG + Intergenic
1028529782 7:91825512-91825534 AAGTTTTGTGAGGAAAATGATGG - Intronic
1030010634 7:105163089-105163111 AATTTCTAAAAGAAATATGAGGG + Intronic
1030101892 7:105954108-105954130 AACTTCTTTGAGGAGTATTTTGG + Intronic
1031276983 7:119737108-119737130 AACTTCAATGTGGCAGATGAAGG - Intergenic
1032244886 7:130202756-130202778 AGTTTTTATGAGGAATAAGAAGG - Intronic
1032361422 7:131258977-131258999 AACTTCTAGGGAGAATGTGAGGG + Intronic
1032678838 7:134160615-134160637 AACTTTTATGATAAATATAAGGG + Intronic
1033731282 7:144182379-144182401 AACATCTATGATGAATATAAAGG + Intergenic
1033740382 7:144270353-144270375 AACATCTATGATGAATATAAAGG - Intergenic
1034325060 7:150222199-150222221 AACTCCTGAGATGAATATGAAGG + Intergenic
1034388154 7:150758093-150758115 AAATTATATGAATAATATGAAGG + Intergenic
1037343563 8:17873390-17873412 AACTTCAGTGAGGAAGTTGATGG + Intronic
1038832253 8:31074460-31074482 AAGTTCTCTGAGTAATAGGAGGG + Intronic
1038922599 8:32101383-32101405 AACAACTATGAGGAATAAAAAGG + Intronic
1040754492 8:50755601-50755623 AACTTCTTTGGGTAATATCATGG + Intronic
1040797481 8:51301733-51301755 AAGTTCTTTGAGAAATCTGAGGG + Intergenic
1043557272 8:81445771-81445793 AAATTCTATCAAAAATATGAGGG - Intronic
1044782831 8:95761160-95761182 AACAGCTAAGAGGGATATGATGG - Intergenic
1044953195 8:97453382-97453404 AACTTCAATGAACAAGATGATGG - Intergenic
1046232112 8:111371670-111371692 AAATTCTATGAGGGCTAAGAGGG - Intergenic
1046899899 8:119512763-119512785 CACATCTAGGAGGAAAATGAGGG + Intergenic
1051941493 9:22510844-22510866 TAGTTGTATGAGAAATATGATGG + Intergenic
1055608547 9:77997236-77997258 AACTTCTATGAGTATTCTCAAGG + Intronic
1056207211 9:84331778-84331800 AATTTCTAAGAGGAAAATGCAGG - Intronic
1056669345 9:88611028-88611050 TACTTCTGTGAAGAATATCATGG + Intergenic
1056786385 9:89595288-89595310 AAGTTCAATGAGGAAGAGGATGG - Intergenic
1058428675 9:104898918-104898940 AACTGTGATGAGGATTATGAAGG - Intronic
1059684539 9:116622260-116622282 AACTTCCAGGAGAAATGTGATGG - Intronic
1186103455 X:6181098-6181120 AGCTGCTATCAGAAATATGAGGG + Intronic
1186578874 X:10795458-10795480 AAATTCTATGATGAATGTCAGGG - Intronic
1188117168 X:26258773-26258795 AATTTCCATGAGGAATAGAATGG + Intergenic
1188937447 X:36194052-36194074 AACTTCTTTGTAGAATGTGAGGG - Intergenic
1188949837 X:36357323-36357345 AAATTCTATGATGAATATAATGG - Intronic
1192070850 X:67939907-67939929 CACTTTTAGGAGGAATATAAAGG - Intergenic
1195527860 X:105913488-105913510 AACTTTTATGATGAACTTGATGG - Intronic
1198408504 X:136340670-136340692 TACATTTATGAGGAATTTGAGGG + Intronic
1199047853 X:143198073-143198095 AACCTCTATGGGGAATATTCTGG - Intergenic