ID: 1155647680

View in Genome Browser
Species Human (GRCh38)
Location 18:28099838-28099860
Sequence GGTAGGTATCACCTTTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155647680 Original CRISPR GGTAGGTATCACCTTTAGAG TGG Intronic
905716742 1:40158493-40158515 GGCATATATCACCTTTAGAATGG - Intergenic
914200329 1:145478929-145478951 GGTAGGTTTGACCCTCAGAGTGG - Intergenic
914479444 1:148052072-148052094 GGTAGGTTTGACCCTCAGAGTGG - Intergenic
916274140 1:162975751-162975773 TGTAGGTAACACATATAGAGAGG - Intergenic
917593539 1:176503060-176503082 GGTAGGTCTCACTTTTACACTGG + Intronic
921545579 1:216470915-216470937 GCCAGGTATTACATTTAGAGTGG - Intergenic
923801297 1:237211879-237211901 GGGAGGTGTCACCTTTATGGTGG + Intronic
1068635241 10:59341105-59341127 GGTAGGTCGCACCTTTAGTAGGG + Intronic
1068903251 10:62293983-62294005 GGAAGGTAAAACCTTTAGGGTGG + Intergenic
1074428839 10:113375515-113375537 GGTAGGTACTACTTCTAGAGAGG + Intergenic
1081516516 11:43836455-43836477 GGAATGTATCACCTTTAAACTGG - Intronic
1081590443 11:44419230-44419252 GGTTGGCATAACCTGTAGAGAGG - Intergenic
1089104463 11:115990702-115990724 GGTAGGCATCAACCTTAGATAGG + Intergenic
1095944668 12:47747021-47747043 GGTAAGTATCACATAAAGAGGGG + Intronic
1099390426 12:82072280-82072302 GGGAGATAGCACCTTTACAGTGG - Intergenic
1102173531 12:110859983-110860005 GGGAGGTATAACCTGGAGAGGGG - Intronic
1108011850 13:46023351-46023373 GGGAGGTAGAACCTCTAGAGAGG - Intronic
1109618179 13:64864450-64864472 GGTTGCTATGTCCTTTAGAGTGG + Intergenic
1114198673 14:20502947-20502969 TGTAAGTATAACCTTTAGACTGG - Intergenic
1115890309 14:38019054-38019076 TGAATGTCTCACCTTTAGAGAGG - Intronic
1117880804 14:60311722-60311744 GGTAGGCATCACCTTAACTGAGG - Intergenic
1128087326 15:64895032-64895054 GGGAGGTAACAGGTTTAGAGAGG + Intronic
1135998022 16:27268120-27268142 GTTAGGTTTCACCCTCAGAGGGG - Intronic
1137592796 16:49704024-49704046 GGCAGGTTTCCCCTTCAGAGTGG + Intronic
1139281062 16:65770872-65770894 TGTTGGTATCACTTTGAGAGAGG + Intergenic
1140722287 16:77782818-77782840 GATACTTATCACCTTTTGAGTGG - Intergenic
1146509689 17:33436191-33436213 GGAAGGGATCAGTTTTAGAGAGG - Intronic
1149615912 17:57998315-57998337 GGAAGGTATAACCTTTAGATAGG - Intronic
1155647680 18:28099838-28099860 GGTAGGTATCACCTTTAGAGTGG + Intronic
1159533537 18:69686007-69686029 TGTAGGTAGTACCTTTAAAGAGG + Intronic
1164800916 19:31075930-31075952 GGTACCTATCACCTATCGAGGGG + Intergenic
1168372521 19:55848336-55848358 GGTAGGGATTAACTTCAGAGTGG - Intronic
925220252 2:2133727-2133749 GGTGGGTACCACCTTTAGACGGG - Intronic
925932587 2:8721694-8721716 GGTAAGTATCACGTCAAGAGTGG + Intergenic
942561757 2:177227164-177227186 GGTAGCTATCATCTTTAAATTGG + Intergenic
1183579824 22:38717360-38717382 GGTAGGTAGTACCTTCAGAGGGG + Intronic
950329733 3:12146852-12146874 GGTAGGTGTTACCTTCTGAGAGG - Intronic
955786964 3:62551037-62551059 GGTTGGCATCACCATGAGAGAGG - Intronic
961200432 3:125041260-125041282 GGTAGTGGTCACCTTTGGAGAGG - Intronic
961418576 3:126781185-126781207 GGAAGGTAGGAGCTTTAGAGGGG + Intronic
961533868 3:127557340-127557362 GGCAGGCATCCCCTTTGGAGTGG + Intergenic
962840508 3:139228206-139228228 GGCAGGTCTGAACTTTAGAGAGG - Intronic
967129507 3:186457647-186457669 GGGAGGCAGCACCTTTTGAGGGG + Intergenic
973651278 4:52999458-52999480 GGGAGGTATCAACATGAGAGGGG + Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG + Intronic
976799873 4:88977299-88977321 GGTAGGTAGCACATACAGAGTGG + Intronic
977487466 4:97666293-97666315 GGTAGGCATCCCATCTAGAGAGG - Intronic
984469771 4:180153937-180153959 GGATGGTATAACCTTTTGAGTGG - Intergenic
989492486 5:42073968-42073990 TGTAGATATGACCTTTAAAGAGG - Intergenic
995492186 5:112705161-112705183 GGCAGCTATCCCATTTAGAGGGG + Intergenic
998363970 5:141616837-141616859 TGTAGGTATTTGCTTTAGAGAGG - Intronic
1000506325 5:162124464-162124486 AATAGGTATGCCCTTTAGAGAGG + Intronic
1000576758 5:162984200-162984222 GTTAAGTATCACCTTTGGATTGG + Intergenic
1007175579 6:39894550-39894572 GATGGGTTTGACCTTTAGAGAGG - Intronic
1022498951 7:30870819-30870841 GCCAGGTATAACATTTAGAGAGG - Intronic
1023328227 7:39083802-39083824 GGTAGGTATCACCATTTCTGAGG + Intronic
1027738688 7:81970995-81971017 GGAAGGTATCACTTGTAGAGAGG + Intronic
1034339457 7:150342153-150342175 GGAAGGTCTCTCCTTTAGGGAGG + Intergenic
1041866397 8:62579534-62579556 TGTAGGTCTCAGCATTAGAGAGG + Exonic
1042263360 8:66883276-66883298 TCTATGTATCACCTTCAGAGAGG - Intronic
1043389379 8:79777399-79777421 GGTAAGTATCACCATTTAAGAGG + Intergenic
1044746786 8:95378444-95378466 TGTAGGTTTCATCTTTGGAGAGG + Intergenic
1045554884 8:103206508-103206530 GGGAGGAATTAGCTTTAGAGGGG - Intronic
1186825321 X:13333965-13333987 TGTAGGTATCACTTCAAGAGAGG + Intergenic
1187416602 X:19098684-19098706 GGGAGGTAGCAATTTTAGAGAGG + Intronic
1189685395 X:43558874-43558896 GGTAGTGATTACCTTTAGGGAGG + Intergenic