ID: 1155649423

View in Genome Browser
Species Human (GRCh38)
Location 18:28122533-28122555
Sequence TTGGACTCCATGGTAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155649423 Original CRISPR TTGGACTCCATGGTAAAGAG TGG Intronic
904532408 1:31177940-31177962 CTGGACCCCATGGTCAGGAGTGG + Intergenic
905037409 1:34927158-34927180 TGGGACTCCTTGCCAAAGAGAGG - Intronic
906158280 1:43627243-43627265 ATGGACTCGATGAGAAAGAGAGG + Intergenic
908330242 1:63063890-63063912 TTGGACTCTATGTCCAAGAGAGG - Intergenic
915458513 1:156055414-156055436 ATGGACTGCATGGTATGGAGAGG + Exonic
920818498 1:209357936-209357958 TTGTATTCCATGGTAAAAAAAGG - Intergenic
923654292 1:235901789-235901811 TAGGAATCCACAGTAAAGAGGGG + Intergenic
1062923868 10:1299785-1299807 TTGGGCTCCTGGGCAAAGAGAGG + Intronic
1064857068 10:19780894-19780916 TTTGTCTCCATGGTAAAGGAAGG - Intronic
1065175077 10:23067991-23068013 TTGGACCCTATGGTACATAGGGG - Intergenic
1068733137 10:60382226-60382248 GTGGACTGCATGGTAAAAAATGG - Intronic
1070533494 10:77358317-77358339 TAAGCCTACATGGTAAAGAGTGG + Intronic
1073563831 10:104518964-104518986 ATGGACTTCAAGGTCAAGAGGGG - Intergenic
1074127501 10:110540942-110540964 TTGCAATCCATGGGGAAGAGAGG + Intergenic
1074407004 10:113188293-113188315 TTGAGCTCCATGGGAAGGAGAGG + Intergenic
1077138046 11:1011340-1011362 CAGGACTCCAGGGTAAAGTGTGG + Exonic
1081189157 11:40081660-40081682 TTAGACTCCATGGCACAGTGGGG - Intergenic
1083682652 11:64358604-64358626 TGGGACCCCATGGCAAGGAGAGG - Intergenic
1085157829 11:74312031-74312053 TCCCACTCCATGGTACAGAGGGG - Intergenic
1085767062 11:79292350-79292372 TTGAGCTCCATGGAAAACAGTGG - Intronic
1088169914 11:106984271-106984293 TTTGACTCCAGTATAAAGAGGGG - Intronic
1088969251 11:114757709-114757731 TTGGTCTTCATGGGGAAGAGTGG + Intergenic
1092039044 12:5367328-5367350 CTGGTCTCCATGGTAAACTGTGG - Intergenic
1096175771 12:49517487-49517509 TTTGACTACATGGAACAGAGTGG + Intronic
1096807160 12:54147825-54147847 ATGGAAACCATGGTACAGAGTGG - Intergenic
1098160828 12:67647770-67647792 TTGGTCTTCAAGGAAAAGAGAGG + Intergenic
1101511158 12:105393632-105393654 TTGGACTCCTTGCTACAGAAAGG - Intronic
1106865916 13:33963920-33963942 ATGGACTACATGTTAAAGTGTGG + Intronic
1109185710 13:59265207-59265229 TTGGCCTCCATAGTAACGGGTGG + Intergenic
1111798669 13:92956370-92956392 CTGGACTCCAGAGTAAAGGGAGG - Intergenic
1115117132 14:29894707-29894729 TTGGATTACATGGTGGAGAGAGG + Intronic
1116008058 14:39317732-39317754 ATGGACTAGAGGGTAAAGAGTGG + Intronic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117674212 14:58139733-58139755 TTTGACTACATGGTTAATAGAGG - Intronic
1121453474 14:94024070-94024092 TGGGGCTCCATTGCAAAGAGTGG + Intergenic
1125067747 15:35510637-35510659 TTGGAGTTCAAGGTGAAGAGTGG - Intronic
1127610002 15:60627424-60627446 TTGGACTCCATAGTACACTGGGG - Exonic
1128714381 15:69896712-69896734 CTGGATTGCATAGTAAAGAGAGG - Intergenic
1135420958 16:22305214-22305236 TGGGACTTGAAGGTAAAGAGGGG + Intronic
1135461553 16:22648107-22648129 TTTGACTTCAAGGTGAAGAGAGG - Intergenic
1136541275 16:30928673-30928695 TTGGGCTCCAGGGTGAAGGGTGG - Intronic
1137741407 16:50779774-50779796 TGAGACTGAATGGTAAAGAGTGG - Exonic
1140600700 16:76471649-76471671 TGGGGCTCCATGGAGAAGAGGGG - Intronic
1144088087 17:11828640-11828662 TTGGACTCTAGGGTACAGTGTGG - Intronic
1144220324 17:13093940-13093962 TTGTTCTCCCTGGTAGAGAGGGG - Intergenic
1144542060 17:16153832-16153854 TTGCTCACCATAGTAAAGAGTGG - Intronic
1144863977 17:18323286-18323308 TTTGGCTCCCTGGTGAAGAGTGG + Intergenic
1146984907 17:37206557-37206579 TTGGAGTCCATAGTATAGAGTGG - Intronic
1148614799 17:48993645-48993667 TTTGACTCCATTTTAAAGATAGG - Intergenic
1148715250 17:49711218-49711240 CTGGTCTCTATGGTAAAGTGGGG + Exonic
1152220755 17:79064062-79064084 TTAGACTACGTGGGAAAGAGAGG + Intergenic
1153272879 18:3340847-3340869 TTGGACTCCATGGGAAAGTAGGG - Intergenic
1153769149 18:8401388-8401410 TTGGTCTCCTTGGCACAGAGTGG + Intronic
1155649423 18:28122533-28122555 TTGGACTCCATGGTAAAGAGTGG + Intronic
1157308529 18:46534702-46534724 CTGGGCTCCATGCTGAAGAGGGG - Intronic
1157596427 18:48866837-48866859 TTTGACACCATTGTAAAGAAGGG + Intergenic
1159449565 18:68583289-68583311 CTGGAATCCATGGAAAATAGGGG + Intergenic
1163455698 19:17404567-17404589 TTGGAGACCATGGTGCAGAGAGG - Intronic
1166563755 19:43750694-43750716 CTGGACTCTATGGGATAGAGCGG - Exonic
1168278368 19:55289517-55289539 TTCGACTACCTGGTAAAGAAGGG + Exonic
937645861 2:124265412-124265434 TTGCACCCCATGGTCATGAGGGG - Intronic
941005096 2:160239803-160239825 TCAGACTCCATGGGAAAGAGAGG + Intronic
943174826 2:184457314-184457336 TGGGAATCCAAAGTAAAGAGAGG + Intergenic
946458626 2:219850327-219850349 CTGCACTCCATGGAAAAGGGAGG + Intergenic
948624500 2:239260781-239260803 CTGCCCTCCATGGGAAAGAGAGG - Intronic
1173268953 20:41514256-41514278 TTAGACTTCATGCTCAAGAGAGG + Intronic
1173773537 20:45684323-45684345 TTAGAACCCAAGGTAAAGAGTGG - Intergenic
1174530429 20:51208462-51208484 ATGGTCTCCATGGTGAAAAGAGG - Intergenic
1177480955 21:21687720-21687742 TTTGACTCCAAGGTACAGAAGGG - Intergenic
1178245936 21:30952283-30952305 TTGGAGTCAATGGTTTAGAGTGG - Intergenic
1178253094 21:31023391-31023413 GTGGTTTCCATGGGAAAGAGCGG - Intergenic
1178402882 21:32302397-32302419 TATGACTCCATGGTAGAGAGAGG + Intronic
1178603625 21:34016251-34016273 CTGTTCTCCATAGTAAAGAGGGG + Intergenic
1180683183 22:17643497-17643519 TTGGACTCCATGTTAACTTGTGG + Intronic
1182119996 22:27780217-27780239 TTGGAGTCCATTCTAAAGTGTGG - Intronic
1182181646 22:28355821-28355843 CTGGACTCCATAGTAAAGCAGGG - Intronic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1182927069 22:34134935-34134957 TTGAGCTCCATGGGAAAGAGTGG - Intergenic
950871755 3:16235480-16235502 TTGCTCTCCATGATAAAGCGAGG + Intergenic
950886579 3:16367726-16367748 CTGGACTCCAGGTTGAAGAGTGG + Intronic
952938916 3:38425186-38425208 TTGGGCTACATGCTAAACAGGGG + Intergenic
962431954 3:135328119-135328141 CAGGACTCCATGCCAAAGAGGGG + Intergenic
966306795 3:178545087-178545109 TTGCACACCATGGTGTAGAGAGG + Intronic
968190913 3:196666486-196666508 ATGGACTCCATGGAAATCAGGGG - Intronic
972509313 4:39752706-39752728 TTGAACTCAATAGTAAATAGAGG + Intronic
974105554 4:57466118-57466140 CTGCACTAGATGGTAAAGAGAGG - Intergenic
976497070 4:85742156-85742178 TTGGCCACCATGGCACAGAGTGG + Intronic
976835643 4:89370038-89370060 TTGTACGCCATGGTAAGAAGTGG - Intergenic
979199283 4:117957504-117957526 TTAGAATCCATGGTAGAGAAGGG + Intergenic
981125360 4:141099737-141099759 TTTGACATGATGGTAAAGAGTGG + Intronic
981518831 4:145639279-145639301 TTGGACTCCATTGTACAAAGTGG + Exonic
986146190 5:5080033-5080055 GTGGACCTCATGGGAAAGAGGGG + Intergenic
989814000 5:45713012-45713034 ATGGACTTGATGGTAAAGAAAGG + Intergenic
990538859 5:56752143-56752165 TAGGACTCCCTGCCAAAGAGTGG + Intergenic
992139628 5:73782667-73782689 TTGGGCAGCAGGGTAAAGAGTGG - Intronic
995431614 5:112085464-112085486 GTGGACTCAGTGGGAAAGAGTGG - Intergenic
996776626 5:127139702-127139724 TTGGAGTCCCTGGAAAAGGGAGG - Intergenic
998224548 5:140316431-140316453 TTAGAATTCCTGGTAAAGAGAGG + Intergenic
1001223609 5:169925143-169925165 GTGTAATACATGGTAAAGAGGGG + Intronic
1001785336 5:174407696-174407718 TGGCTCTACATGGTAAAGAGAGG - Intergenic
1001870220 5:175147870-175147892 TTGGACTCCACTATACAGAGAGG - Intergenic
1002980495 6:2131527-2131549 TTGGACTCCATTGTAAGTTGAGG - Intronic
1008603694 6:53119920-53119942 GTGGACTCCATGGCAGAGACAGG + Intergenic
1008891064 6:56491460-56491482 TTGTACTCCATGGAAGAGAGAGG - Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011819238 6:91231062-91231084 TTGGACTACCTGATAAAGTGAGG + Intergenic
1012125499 6:95423367-95423389 TAGGAATTCATGGGAAAGAGAGG - Intergenic
1014873346 6:126624421-126624443 GTGGTCTTCATGGAAAAGAGTGG + Intergenic
1018324921 6:162656496-162656518 GTGGACTACATGTGAAAGAGAGG - Intronic
1022238000 7:28480741-28480763 TTGTACTGCATGGTAACAAGGGG + Intronic
1023771739 7:43563022-43563044 TTGAACTCCATGATTAAGAAAGG - Exonic
1024698009 7:51876109-51876131 TCAGAATCCATGTTAAAGAGTGG - Intergenic
1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG + Intergenic
1027405972 7:77861241-77861263 TTTGTTTTCATGGTAAAGAGGGG + Intronic
1028273652 7:88824054-88824076 CTGGTCTCCATGGTGCAGAGAGG + Intronic
1035243491 7:157547430-157547452 TGGAACTCCTTGGTACAGAGAGG + Intronic
1037604102 8:20422943-20422965 AGGGGCTCCAAGGTAAAGAGAGG - Intergenic
1037902794 8:22697385-22697407 TTGGACTCCATAGGAGAGAGCGG - Intergenic
1038722418 8:30048826-30048848 TTGGACTTCATGGAAATGAAAGG - Intergenic
1044218598 8:89643504-89643526 TTGGACACCATGATCAAGTGAGG + Intergenic
1044981094 8:97717548-97717570 TAGGACACCATGGTACAGGGTGG - Intronic
1045203184 8:100008516-100008538 TTGGAGTCCAATGTCAAGAGTGG + Exonic
1045414376 8:101951898-101951920 TTGGACTCCATGCTCTGGAGAGG - Intronic
1046067228 8:109211400-109211422 CTGGCCTCCCTGGAAAAGAGAGG - Intergenic
1047202935 8:122781802-122781824 TCGGGCTCCGTGGGAAAGAGGGG - Exonic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1051714262 9:19964967-19964989 TTGAACTCCATGGGGAAGACAGG - Intergenic
1055274019 9:74593682-74593704 TTGGAGTCAATGGAAAAGAAGGG + Intronic
1055649452 9:78392968-78392990 TTGTTCTCCCTGGTAGAGAGGGG - Intergenic
1057278003 9:93686453-93686475 TTGGAGACCAAGGTAAGGAGGGG + Intergenic
1058405977 9:104674578-104674600 TTGTAGGCCATGGTAAGGAGTGG - Intergenic
1060017989 9:120104016-120104038 AGGGACTCCAGGGTCAAGAGTGG + Intergenic
1060453234 9:123763594-123763616 TTTAACACCATGGTAAAGACTGG + Intronic
1060775273 9:126368479-126368501 TTGGATACCGTGGTAGAGAGAGG + Intronic
1061446242 9:130639891-130639913 TTGGGCGCCATGTTAATGAGAGG - Intergenic
1061695387 9:132369491-132369513 TTCTACTCAATGGAAAAGAGTGG - Intergenic
1185728121 X:2439271-2439293 TTGGACTGCAGAGGAAAGAGAGG + Intronic
1187078879 X:15965186-15965208 TTGTTCTCCCTGGTAGAGAGGGG + Intergenic
1187726048 X:22203181-22203203 TTGGTCACCCTGGTAAAGGGTGG + Intronic
1187955197 X:24510875-24510897 TTGGTCTACAAGGAAAAGAGAGG - Intronic
1188233694 X:27699505-27699527 TTGGTTTCCATGGCAAAAAGTGG + Intronic
1188367023 X:29329484-29329506 TTATACTCCATTGTAAAGATAGG - Intronic
1191878479 X:65821018-65821040 TTGTACTCCATAGAAAAGAATGG - Intergenic
1194088332 X:89556012-89556034 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1196759801 X:119190860-119190882 TGTGACTTCATGGTAATGAGAGG - Intergenic
1200441004 Y:3212054-3212076 TGGGACTCCAGGAGAAAGAGAGG - Intergenic