ID: 1155649708

View in Genome Browser
Species Human (GRCh38)
Location 18:28126783-28126805
Sequence GCAGAACTATCGGTCTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155649708 Original CRISPR GCAGAACTATCGGTCTGGTG GGG Intronic
901188289 1:7388927-7388949 GCAGGAAGCTCGGTCTGGTGGGG - Intronic
902234681 1:15049731-15049753 TCAGAACTATAGGCCAGGTGTGG + Intronic
907795653 1:57714047-57714069 AGAGAACTCTCAGTCTGGTGGGG + Intronic
917857961 1:179117123-179117145 ACAGAAGTATAGGCCTGGTGTGG - Intronic
920461378 1:206143306-206143328 TCAGAACTGTCGGTCGGGAGGGG + Intergenic
921562573 1:216676072-216676094 GCAGAACCATTGGTGTGCTGTGG + Intronic
922352026 1:224742200-224742222 GTAGAGCTATAGGCCTGGTGTGG + Intergenic
1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG + Intronic
1077375367 11:2203059-2203081 GCAGAGCCATCGGTGTGGGGAGG + Intergenic
1082846792 11:57732808-57732830 GCTGAACTTTCAGCCTGGTGGGG + Intronic
1083384336 11:62296620-62296642 CCAGGTCTATTGGTCTGGTGGGG - Intronic
1084326507 11:68403450-68403472 GCAGAAATATAGGTCTGGATGGG - Intronic
1085052772 11:73388377-73388399 GCAGACCTATGGGGCTGGGGTGG - Intronic
1092064463 12:5578323-5578345 GCAGAAGGATGGGCCTGGTGGGG + Intronic
1096513502 12:52144569-52144591 ACAGCAATAGCGGTCTGGTGTGG + Intergenic
1099880139 12:88458216-88458238 CCATAACTATTGGTCTGGAGTGG - Intergenic
1101330674 12:103755373-103755395 CCAGAACTGTGGCTCTGGTGTGG + Exonic
1105321789 13:19331325-19331347 GCAGAACTTTGGGACTGGGGGGG - Intergenic
1105876957 13:24564519-24564541 GCAGAACTTTGGGACTGGGGGGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1129244165 15:74269639-74269661 GCAGAACTTTAGGGCTGCTGTGG + Intronic
1130444840 15:83991132-83991154 GCACAACCATCTGTCTGTTGTGG + Exonic
1135617176 16:23921423-23921445 GAAGAGCTTTCGGTCTCGTGAGG + Intronic
1138174534 16:54884598-54884620 GCAGGACTCTCGCTCTGCTGAGG + Intergenic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1141629172 16:85277411-85277433 GCTGAGCTGCCGGTCTGGTGGGG + Intergenic
1147190143 17:38733683-38733705 GCAGGACTACCAGTCTGGTTGGG - Exonic
1148028238 17:44602892-44602914 GCAGAACTTTCAGACTGATGGGG + Intergenic
1155649708 18:28126783-28126805 GCAGAACTATCGGTCTGGTGGGG + Intronic
1157142318 18:45121921-45121943 GCAGAATTAAGGCTCTGGTGCGG + Intergenic
1160044439 18:75373476-75373498 GAAGGGCTATCAGTCTGGTGTGG + Intergenic
1160565912 18:79786484-79786506 GCAAAACTACCTGGCTGGTGTGG - Intergenic
1160773179 19:842877-842899 GCAGAAAAATTGGTCGGGTGCGG - Intronic
1162099623 19:8331946-8331968 GCAGAACTAGGGGTATGGTGGGG + Intronic
1163865069 19:19766632-19766654 ACAGAATTATAGGTCGGGTGTGG + Intergenic
1165710415 19:38006709-38006731 GCAGAACTGTCGCTTTGGAGGGG + Intronic
1168292765 19:55365047-55365069 GAAGACCTATGGGTCAGGTGTGG + Exonic
926706398 2:15840791-15840813 GCAGAAACATCTGTCTGCTGAGG - Intergenic
931391843 2:61851200-61851222 ACAGAATTTTCAGTCTGGTGAGG - Intronic
933286016 2:80385418-80385440 GCAGACCTCTGTGTCTGGTGAGG - Intronic
933755093 2:85632234-85632256 GAAGAACTCCCAGTCTGGTGGGG + Intronic
934707977 2:96498004-96498026 CCAGAACTATCCTTCTGATGGGG - Exonic
1171393213 20:24814771-24814793 GCAGGACTATGGGTCTTGGGTGG - Intergenic
1179677994 21:42997801-42997823 GCAGAACTATCAGGCTGGGGAGG + Intronic
1182856867 22:33525303-33525325 GCAGTACTATGGGCCTGGGGTGG - Intronic
950491400 3:13307265-13307287 GCAGAGCTATGAGTCAGGTGGGG - Intergenic
957968083 3:87346684-87346706 ACAGAAGTATAGGTCGGGTGTGG + Intergenic
961036909 3:123648843-123648865 GCAGGACTCTCAGTCTGGGGAGG + Intronic
961689215 3:128656336-128656358 GCAGGACTGGCTGTCTGGTGAGG + Intronic
963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG + Intergenic
972289320 4:37676938-37676960 GCAGACCTTTAGGTTTGGTGAGG - Intronic
973335610 4:48952936-48952958 GCAAAACTAATGGTCTGGCGTGG + Intergenic
980816297 4:137950810-137950832 GCAGACCTATCTGTCTGGCCTGG + Intergenic
982915305 4:161201750-161201772 GCAGATCTATCAGTCAGTTGGGG + Intergenic
984414920 4:179446094-179446116 GCAGGACTCTCGCTCTGCTGAGG - Intergenic
984427836 4:179610548-179610570 GCAGAACTGTAGGTCTGGAGGGG + Intergenic
984793566 4:183636437-183636459 ACAAAACTATTGGCCTGGTGTGG - Intergenic
990478483 5:56184918-56184940 ACAGAACTATGGGTCAAGTGGGG + Intronic
995407356 5:111814099-111814121 GCAGAAGTATTTGTCTGGTTAGG + Intronic
996586989 5:125100478-125100500 TCAGAACTATCGTTTTGCTGTGG - Intergenic
997329310 5:133047578-133047600 GCAGCACTAGTGGCCTGGTGTGG + Intergenic
999731877 5:154481346-154481368 GCAGAACTCCCGGGATGGTGGGG + Intergenic
1011841055 6:91499501-91499523 TCAGAATGAACGGTCTGGTGAGG + Intergenic
1028532032 7:91848890-91848912 GGATAACAATCGGTTTGGTGGGG + Intronic
1029458072 7:100680921-100680943 GCAGGACTCTGGTTCTGGTGAGG - Exonic
1031020987 7:116627147-116627169 GCAGGACTCTCGCTCTGCTGAGG + Intergenic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1043715790 8:83484541-83484563 GCTGAGCTTTGGGTCTGGTGGGG + Intergenic
1046531485 8:115451709-115451731 GCAGAAAAATCAGCCTGGTGGGG + Intronic
1053441210 9:38117885-38117907 GAAGAACTATGCATCTGGTGGGG - Intergenic
1059990543 9:119861113-119861135 CCAGAACTAACAGACTGGTGGGG - Intergenic
1186863108 X:13692518-13692540 GCATAACTATTTGTCTGGTGAGG - Intronic
1198925695 X:141791869-141791891 GCAGAACTGTCACTCTGGAGTGG + Intergenic