ID: 1155650478

View in Genome Browser
Species Human (GRCh38)
Location 18:28134667-28134689
Sequence TACCACTGCACTGCAGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13419
Summary {0: 1, 1: 20, 2: 473, 3: 4769, 4: 8156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155650473_1155650478 11 Left 1155650473 18:28134633-28134655 CCCAAGAGGTTCAGGTTGCAGTA 0: 1
1: 3
2: 136
3: 3868
4: 44463
Right 1155650478 18:28134667-28134689 TACCACTGCACTGCAGCTTGGGG 0: 1
1: 20
2: 473
3: 4769
4: 8156
1155650474_1155650478 10 Left 1155650474 18:28134634-28134656 CCAAGAGGTTCAGGTTGCAGTAA 0: 1
1: 3
2: 249
3: 6219
4: 64643
Right 1155650478 18:28134667-28134689 TACCACTGCACTGCAGCTTGGGG 0: 1
1: 20
2: 473
3: 4769
4: 8156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155650478 Original CRISPR TACCACTGCACTGCAGCTTG GGG Intronic
Too many off-targets to display for this crispr