ID: 1155651590

View in Genome Browser
Species Human (GRCh38)
Location 18:28150209-28150231
Sequence GCTCCGGCCTGACCTGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 135}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155651590_1155651602 27 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651602 18:28150259-28150281 GATGGAAGGCACGGAGCAGACGG 0: 1
1: 0
2: 5
3: 21
4: 380
1155651590_1155651597 9 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651597 18:28150241-28150263 CCGTGGCCAGAAGCCAGCGATGG 0: 1
1: 0
2: 1
3: 12
4: 128
1155651590_1155651592 -8 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651592 18:28150224-28150246 GCCGGAGCCCAGAAACGCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 86
1155651590_1155651600 18 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651600 18:28150250-28150272 GAAGCCAGCGATGGAAGGCACGG 0: 1
1: 0
2: 0
3: 23
4: 265
1155651590_1155651605 30 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651605 18:28150262-28150284 GGAAGGCACGGAGCAGACGGGGG 0: 1
1: 0
2: 2
3: 18
4: 269
1155651590_1155651598 13 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651598 18:28150245-28150267 GGCCAGAAGCCAGCGATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 170
1155651590_1155651603 28 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651603 18:28150260-28150282 ATGGAAGGCACGGAGCAGACGGG 0: 1
1: 0
2: 2
3: 10
4: 198
1155651590_1155651604 29 Left 1155651590 18:28150209-28150231 CCCATGACAGGTCAGGCCGGAGC 0: 1
1: 0
2: 2
3: 34
4: 135
Right 1155651604 18:28150261-28150283 TGGAAGGCACGGAGCAGACGGGG 0: 1
1: 0
2: 0
3: 8
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155651590 Original CRISPR GCTCCGGCCTGACCTGTCAT GGG (reversed) Intronic
900205884 1:1431732-1431754 GCTCCGGCATGACGTGTGACAGG - Intergenic
900973151 1:6002458-6002480 GCTGTGGCCTGAGCTGGCATCGG + Intronic
901034373 1:6327424-6327446 GCCTGGGCCTGACCTGTCTTTGG - Intronic
903221090 1:21870077-21870099 GCTGGGGCCTGGCCTGGCATAGG + Intronic
904043870 1:27599117-27599139 GCTCCTTCCTGACCTACCATGGG + Intronic
905887944 1:41501791-41501813 GCCCAGGCCTGAGCTGGCATAGG - Intergenic
906220534 1:44074915-44074937 GCTCCAGACTGACCAGTCAGTGG + Intergenic
906837403 1:49098768-49098790 GCTCCAGCCTCACCTGTGAAGGG - Intronic
907340947 1:53735956-53735978 GCTCTGGCCTAACCTGGCCTAGG - Intergenic
910374758 1:86555993-86556015 GCTCTGGACTTAGCTGTCATTGG + Intronic
912946415 1:114088444-114088466 GCTCCTAGCTGACCTGTGATGGG + Intergenic
913937339 1:125066539-125066561 GCTCTGGCCTGACCTCTCCACGG + Intergenic
915579789 1:156806561-156806583 GGTCAGGCCAGACCTGTCAGGGG + Exonic
915903375 1:159861917-159861939 TCTCAGGCCTGAGCTGTCACTGG + Intronic
917443078 1:175083860-175083882 GCTACCTCCTGTCCTGTCATGGG - Exonic
920215906 1:204361491-204361513 GCTCCAGCCTGGCCTGCCCTGGG - Intronic
922338715 1:224638457-224638479 GCTCAGGTCTGACATGGCATGGG - Intronic
924801469 1:247331853-247331875 GCTCCGGCCTTTCCTTTCCTCGG - Intergenic
1064367739 10:14723455-14723477 GATCAGGCATGACCTGTCACGGG + Intronic
1064882581 10:20072615-20072637 GATCTGGCCTGATCTGTCAGTGG + Intronic
1065821831 10:29532828-29532850 GCTCCTGCCTGTCCTCTCAGTGG + Exonic
1076716457 10:132366693-132366715 GCACCAGCCTGACCTGTGTTCGG - Intronic
1078073562 11:8136214-8136236 GCTTCGGCCTTGCCTGTCTTTGG - Intronic
1078527245 11:12110507-12110529 GCTCCGTGCTGTCCTGTCATTGG + Intronic
1083094769 11:60239462-60239484 GCTCCAACCTGTCCTGTCTTGGG + Intronic
1085777426 11:79379275-79379297 ACTCAGGCCTGACCTGGCCTGGG - Intronic
1087022740 11:93619507-93619529 GCTTCCCCCTGACCTGTCTTTGG - Intergenic
1091890367 12:4049067-4049089 GCTAGGACCTGACCTGTCACTGG - Intergenic
1095038415 12:37419008-37419030 GCTCCGGCCTGACCTTTCCACGG - Intergenic
1103701976 12:122853012-122853034 GCTCCTGCCTTGCCTGTGATGGG - Intronic
1103737203 12:123068138-123068160 GAGCTGGCCTGACCTGACATGGG - Intronic
1108408270 13:50125289-50125311 GGTACGGACTGACCTGTCAACGG + Intronic
1119176860 14:72574867-72574889 GCGCCATCATGACCTGTCATTGG - Intergenic
1123708689 15:22969558-22969580 GCTCCGGCCTGATTTCTAATAGG - Intronic
1127996426 15:64155658-64155680 GCTCCTGCCTGACTTTTCCTGGG + Exonic
1131122203 15:89829616-89829638 GCCCTGGCCTGGCCTGTCAGTGG - Intergenic
1132352827 15:101150526-101150548 GCTCCGGAGAGACCTGTCACTGG + Intergenic
1133267120 16:4591934-4591956 GCTCTGGCCTGAGCTGGCAGAGG + Intronic
1136776871 16:32876654-32876676 GCTCCTCCCTGACCTGTGAGGGG + Intergenic
1136893746 16:33984859-33984881 GCTCCTCCCTGACCTGTGAGGGG - Intergenic
1136989580 16:35143892-35143914 GCTCCAGCCTGACCTCTCCCAGG + Intergenic
1203079287 16_KI270728v1_random:1138763-1138785 GCTCCTCCCTGACCTGTGAGGGG + Intergenic
1143719734 17:8801179-8801201 TCTCAGTCCTGACCTGTCCTGGG + Intergenic
1144298394 17:13900480-13900502 GCTCAGACCTAACCTGTCATTGG - Intergenic
1144495382 17:15742137-15742159 GCCACGGCCTGACCTGGGATGGG + Intronic
1145294049 17:21574364-21574386 GCTCCGGCCTGACTTCTCCACGG - Intronic
1145306561 17:21678710-21678732 GCTCCGGCCTGACCTCTTCATGG - Intergenic
1145369782 17:22298822-22298844 GCTCCGGCCTGACTTCTCCACGG + Intergenic
1145379056 17:22377098-22377120 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145379535 17:22379468-22379490 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145380014 17:22381838-22381860 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145380494 17:22384213-22384235 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145380972 17:22386560-22386582 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145381454 17:22388935-22388957 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145382184 17:22392709-22392731 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145382660 17:22395074-22395096 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145382942 17:22396437-22396459 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145383514 17:22399260-22399282 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384029 17:22401728-22401750 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384465 17:22403930-22403952 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384784 17:22405392-22405414 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384911 17:22406022-22406044 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145385562 17:22409457-22409479 GCTTCGGCCTGACCTCTCCACGG + Intergenic
1145385961 17:22411610-22411632 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1148116386 17:45177781-45177803 GCTCAGGCCTGGCCTGTCAGGGG + Intergenic
1148200897 17:45749440-45749462 GTTCCGGCCTGACCCATGATAGG - Intergenic
1151494849 17:74453271-74453293 CCTCAGGCCTGACCTGGCAAAGG - Intergenic
1151884650 17:76916380-76916402 GCTCTGGCCTGGCCTGTGTTGGG + Intronic
1154074784 18:11189164-11189186 GCTCCGGCCTGACCTCTCCAGGG - Intergenic
1155651590 18:28150209-28150231 GCTCCGGCCTGACCTGTCATGGG - Intronic
1157312205 18:46560706-46560728 TCTCCGGCCACACCTGTCCTGGG + Intronic
1158906487 18:62018183-62018205 GCTCCGGCCTGCCCTGGGAAGGG + Intergenic
1158965213 18:62616629-62616651 GCTCCTGCCTCGCCTGTCTTTGG - Intergenic
1160541379 18:79625504-79625526 GAGCCGGCCTGACCCGTCAGCGG - Intergenic
1160620536 18:80167516-80167538 GCTGCTGCCTTGCCTGTCATGGG - Intronic
1160804236 19:984769-984791 GCTCAGGCCTGAGCTGCTATGGG + Intronic
1163932859 19:20414423-20414445 GCTCCAGCCTGGCTTATCATTGG - Intergenic
1165304708 19:34996282-34996304 GCCCAGGTCTGACCTGTCCTGGG - Intronic
1165595765 19:37010196-37010218 ACTCCGGCCTGACCTCTCCATGG + Intronic
1165596155 19:37012454-37012476 GCTCCGGCCTGACCTCTCCAGGG + Intronic
1165601251 19:37057126-37057148 GCTCTGGCCTGACCTCTCCACGG + Intronic
1165601682 19:37059479-37059501 GCTCCGGCCTGACCTCTCCACGG + Intronic
1166720418 19:44992984-44993006 GCCCCGGCCTGATCTGTCCAGGG - Exonic
1166763396 19:45238510-45238532 GCTCCGGACTCACCTGACAATGG + Intronic
1166765951 19:45252078-45252100 GCTCCGGCCTTCCCTGTCTGGGG + Intronic
1168270867 19:55249054-55249076 GCTCCACCCTCAACTGTCATTGG - Intronic
925340617 2:3132879-3132901 GGTCAGAGCTGACCTGTCATTGG + Intergenic
928063284 2:28136464-28136486 TCTCCAGCCAGACCTGTCAATGG - Intronic
930019883 2:46995103-46995125 GCTCTAGCCAGGCCTGTCATTGG + Intronic
936988239 2:118332567-118332589 GCTCCAGACTCACCTGTCAGGGG - Intergenic
945881189 2:215326969-215326991 GCTCGGGCTTTACCTGTGATGGG - Exonic
948987833 2:241536179-241536201 GCTCTGGTCTGACCTGTGTTGGG + Intergenic
1169569080 20:6887227-6887249 GCTCAGGCCTGGCCTGCCTTGGG + Intergenic
1171524473 20:25798432-25798454 GCTCCGGTCTGACCTCTCCACGG - Intronic
1171532446 20:25861532-25861554 GCTCCGGCCTGACCTCTCCTCGG - Intronic
1171532775 20:25863189-25863211 GCTCCGGCCTGACCTCTCCTCGG - Exonic
1171533221 20:25865722-25865744 GCTCCGGCCTGACCTCTCCACGG - Intronic
1171533663 20:25868082-25868104 GCTCCGGCCTGACCTCTTCACGG - Intronic
1171544076 20:25987441-25987463 GCTCTGGCCTGACCTCTCCACGG + Intergenic
1171552354 20:26057451-26057473 GCTCCGGTCTGACCTCTCCACGG + Intergenic
1171807143 20:29689925-29689947 GCTCTGGCCTGACCTCTCCACGG + Intergenic
1171837223 20:30168241-30168263 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1171846726 20:30281855-30281877 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1173380164 20:42532781-42532803 GCTTAGGCTTGACCAGTCATGGG + Intronic
1176656514 21:9592718-9592740 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1176679362 21:9811148-9811170 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1176679936 21:9813965-9813987 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1176680789 21:9818192-9818214 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1176681640 21:9822423-9822445 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1183158643 22:36095147-36095169 ACTCAGGCCTGACTTGTGATTGG - Intergenic
1184064618 22:42110649-42110671 GATCCGGCCTGACCTTTGTTTGG + Intergenic
1185103066 22:48852009-48852031 GCTCGGGCCTCATCTGTTATTGG + Intergenic
950367361 3:12497041-12497063 GCTCATGCCTGACCTCTCCTGGG + Intronic
950453378 3:13078336-13078358 GCTCCATCCTGTCCTGCCATTGG - Intergenic
952416256 3:33093685-33093707 GCTCAGGCCTGCCCTGGCAGTGG - Exonic
953656920 3:44861719-44861741 CCTCCGGCCTAACCTGTAGTAGG - Intronic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
963109840 3:141678942-141678964 ACTCCAGCCTGTCCTGTCATGGG + Intergenic
968489985 4:884784-884806 CCTCCGGCCTGCTCTGTCCTGGG - Intronic
969590314 4:8118303-8118325 GCTCCTGCCTGAGCTCTCAAGGG - Intronic
981580385 4:146244044-146244066 GCTCCTGCTCGACCTGTCAGCGG + Intergenic
982184302 4:152780217-152780239 GCTCCGCCCTCACCTTTCTTAGG - Intronic
985725611 5:1514435-1514457 GCTCAGGACTGACCTGTCGAAGG - Intronic
987118466 5:14744903-14744925 CCGCCGGCCTGACCTCTCCTGGG - Intronic
992791887 5:80220999-80221021 GCTCAGGGCTGACCTGTTTTGGG - Intronic
993016490 5:82540419-82540441 GCTGAGGCTAGACCTGTCATGGG - Intergenic
997580913 5:135016355-135016377 GCTCTGGCCTGACCTCTGTTTGG - Intergenic
1003184174 6:3816173-3816195 GCTTAGGCCTTACCTGACATCGG + Intergenic
1012907138 6:105080421-105080443 TCTCCCGCCTGTCCTGTCATGGG + Exonic
1016984611 6:149885597-149885619 CCTCCCTCCTGACCTGTGATTGG + Intronic
1018134287 6:160764582-160764604 GCTCTGGCCTGGCCTGGCCTGGG - Intergenic
1021841140 7:24722841-24722863 TCTCAGGACTGCCCTGTCATCGG - Intronic
1025268190 7:57485093-57485115 GCTCCGGACTGACCTCTCCACGG + Intergenic
1025284942 7:57653500-57653522 ACTCCGGCCTGACCTCTCCACGG - Intergenic
1025295457 7:57772525-57772547 GCTCTGGCCTGACCTCTCCACGG + Intergenic
1025301003 7:57819747-57819769 GCTCCAGCCTGACCTCTCCACGG + Intergenic
1025301477 7:57822128-57822150 ACTCCGGCCTGACCTCTCCACGG + Intergenic
1035359476 7:158301111-158301133 TCTCCGTCTTGACTTGTCATGGG - Intronic
1038379673 8:27080759-27080781 GCTTCGGTTTGACCTCTCATCGG - Intergenic
1053415214 9:37943141-37943163 GCTCCGCCCTGCCCTGTCTCTGG + Intronic
1053418118 9:37959409-37959431 GCTGCGGCTTGCCCTGGCATAGG + Intronic
1053784419 9:41644093-41644115 GATCCGGCCTGACCTCTCCACGG + Intergenic
1053784822 9:41646252-41646274 GCTCCGGCCTAACCTCTTCTTGG - Intergenic
1054160881 9:61671500-61671522 GCTCTGGCCTCACCTGCCACGGG - Intergenic
1054172851 9:61856664-61856686 GCTCCGGCCTCACCTCTCCACGG + Intergenic
1054173146 9:61858066-61858088 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1054447707 9:65385698-65385720 GCTCCGGCCTCACCTCTCCACGG + Intergenic
1054447999 9:65387108-65387130 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1054448404 9:65389262-65389284 GCTCCGGCCTAACCTCTTCTTGG - Intergenic
1054663994 9:67720584-67720606 GCTCCGGCCTAACCTCTTCTTGG + Intergenic
1054664396 9:67722715-67722737 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1054664689 9:67724137-67724159 GCTCCGGCCTCACCTCTCCACGG - Intergenic
1056100727 9:83298351-83298373 ACTCCGGGCTGACCTTTCATGGG - Intronic
1057973912 9:99583648-99583670 CCTAGGGCCTGACCTGTCACAGG + Intergenic
1059487459 9:114637745-114637767 GCTCCGGGATGACCTGTTACCGG + Intronic
1203634229 Un_KI270750v1:96200-96222 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1203664531 Un_KI270754v1:13684-13706 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1203666238 Un_KI270754v1:22135-22157 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1203667093 Un_KI270754v1:26365-26387 GCTCCGGCCTCACCTCTCCACGG - Intergenic
1203667387 Un_KI270754v1:27774-27796 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1203668241 Un_KI270754v1:32004-32026 GCTCCGGCCTCACCTCTCCACGG - Intergenic
1203668536 Un_KI270754v1:33413-33435 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1203669379 Un_KI270754v1:37639-37661 GCTCCGGCCTCACCTTTCCACGG - Intergenic
1203669667 Un_KI270754v1:39046-39068 GCTCCGGCCTCACCTCTCCACGG - Intergenic
1194163031 X:90478967-90478989 TCTCCGACCTGAGATGTCATTGG + Intergenic
1195703018 X:107719030-107719052 TCTCCGAGCTGACCTTTCATTGG + Intronic
1196212285 X:113009565-113009587 GTTATGGCCTGGCCTGTCATGGG - Intergenic
1200102988 X:153697390-153697412 GCTCCTCCCTGACCTGTGAGGGG - Intergenic
1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG + Exonic
1200509307 Y:4056699-4056721 TCTCCGACCTGAGATGTCATTGG + Intergenic
1200919373 Y:8599501-8599523 GCTCAGGTCTGCCCTGTCCTGGG - Intergenic
1200937999 Y:8755212-8755234 GCTCAGGTCTGACCTCTCAGAGG + Intergenic