ID: 1155679839

View in Genome Browser
Species Human (GRCh38)
Location 18:28475541-28475563
Sequence TCTAGCCAAAGGACCTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155679830_1155679839 30 Left 1155679830 18:28475488-28475510 CCCAGAGAGCCAATGAGTGCAGA No data
Right 1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG No data
1155679836_1155679839 -7 Left 1155679836 18:28475525-28475547 CCAAAAGCCTACTCTCTCTAGCC No data
Right 1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG No data
1155679835_1155679839 -6 Left 1155679835 18:28475524-28475546 CCCAAAAGCCTACTCTCTCTAGC No data
Right 1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG No data
1155679834_1155679839 -5 Left 1155679834 18:28475523-28475545 CCCCAAAAGCCTACTCTCTCTAG No data
Right 1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG No data
1155679832_1155679839 21 Left 1155679832 18:28475497-28475519 CCAATGAGTGCAGACAAAAACAG No data
Right 1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG No data
1155679831_1155679839 29 Left 1155679831 18:28475489-28475511 CCAGAGAGCCAATGAGTGCAGAC No data
Right 1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG No data
1155679833_1155679839 -4 Left 1155679833 18:28475522-28475544 CCCCCAAAAGCCTACTCTCTCTA No data
Right 1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155679839 Original CRISPR TCTAGCCAAAGGACCTAGAT AGG Intergenic
No off target data available for this crispr