ID: 1155679882

View in Genome Browser
Species Human (GRCh38)
Location 18:28475836-28475858
Sequence GCAGTTCCTGCTTTTTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155679882_1155679893 7 Left 1155679882 18:28475836-28475858 CCACAGCAAAAAGCAGGAACTGC No data
Right 1155679893 18:28475866-28475888 GGGGCCAACTAAGGCAGAGTGGG No data
1155679882_1155679896 15 Left 1155679882 18:28475836-28475858 CCACAGCAAAAAGCAGGAACTGC No data
Right 1155679896 18:28475874-28475896 CTAAGGCAGAGTGGGGAACTTGG No data
1155679882_1155679892 6 Left 1155679882 18:28475836-28475858 CCACAGCAAAAAGCAGGAACTGC No data
Right 1155679892 18:28475865-28475887 GGGGGCCAACTAAGGCAGAGTGG No data
1155679882_1155679894 8 Left 1155679882 18:28475836-28475858 CCACAGCAAAAAGCAGGAACTGC No data
Right 1155679894 18:28475867-28475889 GGGCCAACTAAGGCAGAGTGGGG No data
1155679882_1155679887 -2 Left 1155679882 18:28475836-28475858 CCACAGCAAAAAGCAGGAACTGC No data
Right 1155679887 18:28475857-28475879 GCCCCCTTGGGGGCCAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155679882 Original CRISPR GCAGTTCCTGCTTTTTGCTG TGG (reversed) Intergenic
No off target data available for this crispr