ID: 1155680620

View in Genome Browser
Species Human (GRCh38)
Location 18:28481798-28481820
Sequence TTACCCTGATCCAGTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155680617_1155680620 5 Left 1155680617 18:28481770-28481792 CCACTGTTAATCCTGTTTGCTCT No data
Right 1155680620 18:28481798-28481820 TTACCCTGATCCAGTGTTGATGG No data
1155680615_1155680620 20 Left 1155680615 18:28481755-28481777 CCAGACACCATGCTGCCACTGTT No data
Right 1155680620 18:28481798-28481820 TTACCCTGATCCAGTGTTGATGG No data
1155680613_1155680620 25 Left 1155680613 18:28481750-28481772 CCCAACCAGACACCATGCTGCCA No data
Right 1155680620 18:28481798-28481820 TTACCCTGATCCAGTGTTGATGG No data
1155680618_1155680620 -6 Left 1155680618 18:28481781-28481803 CCTGTTTGCTCTCCAAATTACCC No data
Right 1155680620 18:28481798-28481820 TTACCCTGATCCAGTGTTGATGG No data
1155680614_1155680620 24 Left 1155680614 18:28481751-28481773 CCAACCAGACACCATGCTGCCAC No data
Right 1155680620 18:28481798-28481820 TTACCCTGATCCAGTGTTGATGG No data
1155680616_1155680620 13 Left 1155680616 18:28481762-28481784 CCATGCTGCCACTGTTAATCCTG No data
Right 1155680620 18:28481798-28481820 TTACCCTGATCCAGTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155680620 Original CRISPR TTACCCTGATCCAGTGTTGA TGG Intergenic