ID: 1155680764

View in Genome Browser
Species Human (GRCh38)
Location 18:28482930-28482952
Sequence TTGGTAAGCAAACCTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155680764_1155680769 17 Left 1155680764 18:28482930-28482952 CCTGGGGCAGGTTTGCTTACCAA No data
Right 1155680769 18:28482970-28482992 CTGAAACCCTACACTAACACAGG No data
1155680764_1155680770 22 Left 1155680764 18:28482930-28482952 CCTGGGGCAGGTTTGCTTACCAA No data
Right 1155680770 18:28482975-28482997 ACCCTACACTAACACAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155680764 Original CRISPR TTGGTAAGCAAACCTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr