ID: 1155683789

View in Genome Browser
Species Human (GRCh38)
Location 18:28521500-28521522
Sequence CACTAACCACCTAGGGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155683789_1155683794 -6 Left 1155683789 18:28521500-28521522 CCATAGACCCTAGGTGGTTAGTG No data
Right 1155683794 18:28521517-28521539 TTAGTGGGCTAATACCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155683789 Original CRISPR CACTAACCACCTAGGGTCTA TGG (reversed) Intergenic
No off target data available for this crispr