ID: 1155685420

View in Genome Browser
Species Human (GRCh38)
Location 18:28542507-28542529
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155685419_1155685420 -2 Left 1155685419 18:28542486-28542508 CCATGGGTGGCTATTTTAATATC No data
Right 1155685420 18:28542507-28542529 TCATCTTGATATAGTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155685420 Original CRISPR TCATCTTGATATAGTCCTGA AGG Intergenic
No off target data available for this crispr