ID: 1155686136

View in Genome Browser
Species Human (GRCh38)
Location 18:28553757-28553779
Sequence GCATGCCCTCCTGGCAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155686136_1155686138 16 Left 1155686136 18:28553757-28553779 CCATCATTGCCAGGAGGGCATGC No data
Right 1155686138 18:28553796-28553818 ATTCTCTGATCAGAAGTGTGAGG No data
1155686136_1155686139 29 Left 1155686136 18:28553757-28553779 CCATCATTGCCAGGAGGGCATGC No data
Right 1155686139 18:28553809-28553831 AAGTGTGAGGAACTTTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155686136 Original CRISPR GCATGCCCTCCTGGCAATGA TGG (reversed) Intergenic
No off target data available for this crispr