ID: 1155702100

View in Genome Browser
Species Human (GRCh38)
Location 18:28758921-28758943
Sequence TCTTATATGAAGGAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155702097_1155702100 -3 Left 1155702097 18:28758901-28758923 CCAGAGGAGAAAAAGTTATCTCT No data
Right 1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG No data
1155702096_1155702100 -2 Left 1155702096 18:28758900-28758922 CCCAGAGGAGAAAAAGTTATCTC No data
Right 1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155702100 Original CRISPR TCTTATATGAAGGAGTTGGA TGG Intergenic
No off target data available for this crispr