ID: 1155706499

View in Genome Browser
Species Human (GRCh38)
Location 18:28822120-28822142
Sequence TGTCCAATGCTAAGCATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155706492_1155706499 23 Left 1155706492 18:28822074-28822096 CCATTTAAGTCTGATGTTTCTTT No data
Right 1155706499 18:28822120-28822142 TGTCCAATGCTAAGCATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155706499 Original CRISPR TGTCCAATGCTAAGCATGGG GGG Intergenic
No off target data available for this crispr