ID: 1155708603

View in Genome Browser
Species Human (GRCh38)
Location 18:28847529-28847551
Sequence CTGCAGCAGCAGTGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155708603_1155708609 7 Left 1155708603 18:28847529-28847551 CCCCTCTGCCACTGCTGCTGCAG No data
Right 1155708609 18:28847559-28847581 ACCCTTGCTGCTCTGAGACTGGG No data
1155708603_1155708611 8 Left 1155708603 18:28847529-28847551 CCCCTCTGCCACTGCTGCTGCAG No data
Right 1155708611 18:28847560-28847582 CCCTTGCTGCTCTGAGACTGGGG No data
1155708603_1155708608 6 Left 1155708603 18:28847529-28847551 CCCCTCTGCCACTGCTGCTGCAG No data
Right 1155708608 18:28847558-28847580 TACCCTTGCTGCTCTGAGACTGG No data
1155708603_1155708613 12 Left 1155708603 18:28847529-28847551 CCCCTCTGCCACTGCTGCTGCAG No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155708603 Original CRISPR CTGCAGCAGCAGTGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr