ID: 1155708613

View in Genome Browser
Species Human (GRCh38)
Location 18:28847564-28847586
Sequence TGCTGCTCTGAGACTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155708605_1155708613 10 Left 1155708605 18:28847531-28847553 CCTCTGCCACTGCTGCTGCAGTG No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data
1155708600_1155708613 30 Left 1155708600 18:28847511-28847533 CCCAGTGGCAACCAAAATCCCCT No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data
1155708603_1155708613 12 Left 1155708603 18:28847529-28847551 CCCCTCTGCCACTGCTGCTGCAG No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data
1155708607_1155708613 4 Left 1155708607 18:28847537-28847559 CCACTGCTGCTGCAGTGGTGCTA No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data
1155708602_1155708613 19 Left 1155708602 18:28847522-28847544 CCAAAATCCCCTCTGCCACTGCT No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data
1155708601_1155708613 29 Left 1155708601 18:28847512-28847534 CCAGTGGCAACCAAAATCCCCTC No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data
1155708604_1155708613 11 Left 1155708604 18:28847530-28847552 CCCTCTGCCACTGCTGCTGCAGT No data
Right 1155708613 18:28847564-28847586 TGCTGCTCTGAGACTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155708613 Original CRISPR TGCTGCTCTGAGACTGGGGA AGG Intergenic
No off target data available for this crispr