ID: 1155710653

View in Genome Browser
Species Human (GRCh38)
Location 18:28874073-28874095
Sequence GTGTGAAATGCATTTTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155710653_1155710656 13 Left 1155710653 18:28874073-28874095 CCAGAAAAAAATGCATTTCACAC No data
Right 1155710656 18:28874109-28874131 ATAAAGTTGCTGAGCAAACTGGG No data
1155710653_1155710655 12 Left 1155710653 18:28874073-28874095 CCAGAAAAAAATGCATTTCACAC No data
Right 1155710655 18:28874108-28874130 CATAAAGTTGCTGAGCAAACTGG No data
1155710653_1155710657 29 Left 1155710653 18:28874073-28874095 CCAGAAAAAAATGCATTTCACAC No data
Right 1155710657 18:28874125-28874147 AACTGGGAGCTAAAGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155710653 Original CRISPR GTGTGAAATGCATTTTTTTC TGG (reversed) Intergenic
No off target data available for this crispr