ID: 1155710654

View in Genome Browser
Species Human (GRCh38)
Location 18:28874100-28874122
Sequence CTCAGCAACTTTATGATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155710654_1155710657 2 Left 1155710654 18:28874100-28874122 CCAAGAATCATAAAGTTGCTGAG No data
Right 1155710657 18:28874125-28874147 AACTGGGAGCTAAAGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155710654 Original CRISPR CTCAGCAACTTTATGATTCT TGG (reversed) Intergenic