ID: 1155710654 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:28874100-28874122 |
| Sequence | CTCAGCAACTTTATGATTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155710654_1155710657 | 2 | Left | 1155710654 | 18:28874100-28874122 | CCAAGAATCATAAAGTTGCTGAG | No data | ||
| Right | 1155710657 | 18:28874125-28874147 | AACTGGGAGCTAAAGAACTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155710654 | Original CRISPR | CTCAGCAACTTTATGATTCT TGG (reversed) | Intergenic | ||