ID: 1155710655

View in Genome Browser
Species Human (GRCh38)
Location 18:28874108-28874130
Sequence CATAAAGTTGCTGAGCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155710653_1155710655 12 Left 1155710653 18:28874073-28874095 CCAGAAAAAAATGCATTTCACAC No data
Right 1155710655 18:28874108-28874130 CATAAAGTTGCTGAGCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155710655 Original CRISPR CATAAAGTTGCTGAGCAAAC TGG Intergenic