ID: 1155710656

View in Genome Browser
Species Human (GRCh38)
Location 18:28874109-28874131
Sequence ATAAAGTTGCTGAGCAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155710653_1155710656 13 Left 1155710653 18:28874073-28874095 CCAGAAAAAAATGCATTTCACAC No data
Right 1155710656 18:28874109-28874131 ATAAAGTTGCTGAGCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155710656 Original CRISPR ATAAAGTTGCTGAGCAAACT GGG Intergenic