ID: 1155710663

View in Genome Browser
Species Human (GRCh38)
Location 18:28874272-28874294
Sequence AGTTTTAAGACTGCATGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155710663_1155710665 1 Left 1155710663 18:28874272-28874294 CCTGAACATGCAGTCTTAAAACT No data
Right 1155710665 18:28874296-28874318 TTTGGAGTCTTTAGAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155710663 Original CRISPR AGTTTTAAGACTGCATGTTC AGG (reversed) Intergenic
No off target data available for this crispr