ID: 1155713641

View in Genome Browser
Species Human (GRCh38)
Location 18:28912517-28912539
Sequence CTGTTTGCACAGAAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155713641_1155713643 -10 Left 1155713641 18:28912517-28912539 CCTCTCTCTTTCTGTGCAAACAG No data
Right 1155713643 18:28912530-28912552 GTGCAAACAGGTTGAGTGAATGG No data
1155713641_1155713644 20 Left 1155713641 18:28912517-28912539 CCTCTCTCTTTCTGTGCAAACAG No data
Right 1155713644 18:28912560-28912582 CACTGTTTGTCTCCTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155713641 Original CRISPR CTGTTTGCACAGAAAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr