ID: 1155717913

View in Genome Browser
Species Human (GRCh38)
Location 18:28969897-28969919
Sequence CACCTACCCATGATCTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155717907_1155717913 9 Left 1155717907 18:28969865-28969887 CCAGCCTTGTGCTTCCACAAGGG No data
Right 1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG No data
1155717911_1155717913 -5 Left 1155717911 18:28969879-28969901 CCACAAGGGTTTGGCTCTCACCT No data
Right 1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG No data
1155717909_1155717913 5 Left 1155717909 18:28969869-28969891 CCTTGTGCTTCCACAAGGGTTTG No data
Right 1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG No data
1155717903_1155717913 18 Left 1155717903 18:28969856-28969878 CCATTCCCTCCAGCCTTGTGCTT No data
Right 1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG No data
1155717905_1155717913 12 Left 1155717905 18:28969862-28969884 CCTCCAGCCTTGTGCTTCCACAA No data
Right 1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG No data
1155717904_1155717913 13 Left 1155717904 18:28969861-28969883 CCCTCCAGCCTTGTGCTTCCACA No data
Right 1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155717913 Original CRISPR CACCTACCCATGATCTAGGT TGG Intergenic
No off target data available for this crispr