ID: 1155724105

View in Genome Browser
Species Human (GRCh38)
Location 18:29057597-29057619
Sequence GAGTTCTAGGGTAGGATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155724105_1155724109 -9 Left 1155724105 18:29057597-29057619 CCATAAATCCTACCCTAGAACTC No data
Right 1155724109 18:29057611-29057633 CTAGAACTCCTGATTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155724105 Original CRISPR GAGTTCTAGGGTAGGATTTA TGG (reversed) Intergenic
No off target data available for this crispr