ID: 1155724775

View in Genome Browser
Species Human (GRCh38)
Location 18:29067078-29067100
Sequence CTGGTAAAGCAGCATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155724775_1155724782 19 Left 1155724775 18:29067078-29067100 CCATCCTCATGCTGCTTTACCAG No data
Right 1155724782 18:29067120-29067142 TGTCAAGAACACTTGGCCTGAGG No data
1155724775_1155724779 -10 Left 1155724775 18:29067078-29067100 CCATCCTCATGCTGCTTTACCAG No data
Right 1155724779 18:29067091-29067113 GCTTTACCAGTGGGAGTCTGTGG No data
1155724775_1155724781 12 Left 1155724775 18:29067078-29067100 CCATCCTCATGCTGCTTTACCAG No data
Right 1155724781 18:29067113-29067135 GATGAGCTGTCAAGAACACTTGG No data
1155724775_1155724783 26 Left 1155724775 18:29067078-29067100 CCATCCTCATGCTGCTTTACCAG No data
Right 1155724783 18:29067127-29067149 AACACTTGGCCTGAGGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155724775 Original CRISPR CTGGTAAAGCAGCATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr