ID: 1155725807

View in Genome Browser
Species Human (GRCh38)
Location 18:29081536-29081558
Sequence AGATATTTGGAGAAGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155725807_1155725812 20 Left 1155725807 18:29081536-29081558 CCTCTCATCTTCTCCAAATATCT No data
Right 1155725812 18:29081579-29081601 CCCCAGACCATTACTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155725807 Original CRISPR AGATATTTGGAGAAGATGAG AGG (reversed) Intergenic
No off target data available for this crispr