ID: 1155729113

View in Genome Browser
Species Human (GRCh38)
Location 18:29130130-29130152
Sequence TATTCTAGTTAGGAAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155729113_1155729116 -7 Left 1155729113 18:29130130-29130152 CCCTCAACTTCCTAACTAGAATA No data
Right 1155729116 18:29130146-29130168 TAGAATATCCAAAACTAGAGAGG No data
1155729113_1155729117 -6 Left 1155729113 18:29130130-29130152 CCCTCAACTTCCTAACTAGAATA No data
Right 1155729117 18:29130147-29130169 AGAATATCCAAAACTAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155729113 Original CRISPR TATTCTAGTTAGGAAGTTGA GGG (reversed) Intergenic
No off target data available for this crispr