ID: 1155732701

View in Genome Browser
Species Human (GRCh38)
Location 18:29180717-29180739
Sequence TCCGTATGTTGAGGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155732697_1155732701 9 Left 1155732697 18:29180685-29180707 CCATAAAATAAAGGAAAATTTGG No data
Right 1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155732701 Original CRISPR TCCGTATGTTGAGGGAATGC TGG Intergenic
No off target data available for this crispr