ID: 1155736257

View in Genome Browser
Species Human (GRCh38)
Location 18:29226330-29226352
Sequence ATGCAGATCAACAATCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155736252_1155736257 -8 Left 1155736252 18:29226315-29226337 CCACCTGCACTTCCAATGCAGAT No data
Right 1155736257 18:29226330-29226352 ATGCAGATCAACAATCAGGTGGG No data
1155736251_1155736257 26 Left 1155736251 18:29226281-29226303 CCAAATCTCAGTGACTCAAGGAA No data
Right 1155736257 18:29226330-29226352 ATGCAGATCAACAATCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155736257 Original CRISPR ATGCAGATCAACAATCAGGT GGG Intergenic
No off target data available for this crispr