ID: 1155741697 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:29297431-29297453 |
| Sequence | CTTTCATTGCTGAAGGTTAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155741688_1155741697 | 20 | Left | 1155741688 | 18:29297388-29297410 | CCAGGTATTGGTTGTGGTTTTTT | No data | ||
| Right | 1155741697 | 18:29297431-29297453 | CTTTCATTGCTGAAGGTTATGGG | No data | ||||
| 1155741691_1155741697 | -5 | Left | 1155741691 | 18:29297413-29297435 | CCGGTGAAGTGCCCCAAACTTTC | No data | ||
| Right | 1155741697 | 18:29297431-29297453 | CTTTCATTGCTGAAGGTTATGGG | No data | ||||
| 1155741690_1155741697 | -4 | Left | 1155741690 | 18:29297412-29297434 | CCCGGTGAAGTGCCCCAAACTTT | No data | ||
| Right | 1155741697 | 18:29297431-29297453 | CTTTCATTGCTGAAGGTTATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155741697 | Original CRISPR | CTTTCATTGCTGAAGGTTAT GGG | Intergenic | ||
| No off target data available for this crispr | |||||