ID: 1155741697

View in Genome Browser
Species Human (GRCh38)
Location 18:29297431-29297453
Sequence CTTTCATTGCTGAAGGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155741688_1155741697 20 Left 1155741688 18:29297388-29297410 CCAGGTATTGGTTGTGGTTTTTT No data
Right 1155741697 18:29297431-29297453 CTTTCATTGCTGAAGGTTATGGG No data
1155741691_1155741697 -5 Left 1155741691 18:29297413-29297435 CCGGTGAAGTGCCCCAAACTTTC No data
Right 1155741697 18:29297431-29297453 CTTTCATTGCTGAAGGTTATGGG No data
1155741690_1155741697 -4 Left 1155741690 18:29297412-29297434 CCCGGTGAAGTGCCCCAAACTTT No data
Right 1155741697 18:29297431-29297453 CTTTCATTGCTGAAGGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155741697 Original CRISPR CTTTCATTGCTGAAGGTTAT GGG Intergenic
No off target data available for this crispr