ID: 1155744140

View in Genome Browser
Species Human (GRCh38)
Location 18:29330368-29330390
Sequence TTACTCTCCTTGGCCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155744137_1155744140 23 Left 1155744137 18:29330322-29330344 CCATACGGTAGTGCACATTTTAC No data
Right 1155744140 18:29330368-29330390 TTACTCTCCTTGGCCAATGCAGG No data
1155744136_1155744140 24 Left 1155744136 18:29330321-29330343 CCCATACGGTAGTGCACATTTTA No data
Right 1155744140 18:29330368-29330390 TTACTCTCCTTGGCCAATGCAGG No data
1155744138_1155744140 -1 Left 1155744138 18:29330346-29330368 CCATGTTCTGATTCAATTGAAGT No data
Right 1155744140 18:29330368-29330390 TTACTCTCCTTGGCCAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155744140 Original CRISPR TTACTCTCCTTGGCCAATGC AGG Intergenic
No off target data available for this crispr