ID: 1155744153

View in Genome Browser
Species Human (GRCh38)
Location 18:29330512-29330534
Sequence ACACATAGCTGTAGCTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155744153_1155744156 -4 Left 1155744153 18:29330512-29330534 CCTAGGAAGCTACAGCTATGTGT No data
Right 1155744156 18:29330531-29330553 GTGTTTGTGTTGTTGAGGGTAGG No data
1155744153_1155744155 -8 Left 1155744153 18:29330512-29330534 CCTAGGAAGCTACAGCTATGTGT No data
Right 1155744155 18:29330527-29330549 CTATGTGTTTGTGTTGTTGAGGG No data
1155744153_1155744157 14 Left 1155744153 18:29330512-29330534 CCTAGGAAGCTACAGCTATGTGT No data
Right 1155744157 18:29330549-29330571 GTAGGAAATGAAACTGCCAATGG No data
1155744153_1155744154 -9 Left 1155744153 18:29330512-29330534 CCTAGGAAGCTACAGCTATGTGT No data
Right 1155744154 18:29330526-29330548 GCTATGTGTTTGTGTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155744153 Original CRISPR ACACATAGCTGTAGCTTCCT AGG (reversed) Intergenic
No off target data available for this crispr