ID: 1155744155

View in Genome Browser
Species Human (GRCh38)
Location 18:29330527-29330549
Sequence CTATGTGTTTGTGTTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155744152_1155744155 -7 Left 1155744152 18:29330511-29330533 CCCTAGGAAGCTACAGCTATGTG No data
Right 1155744155 18:29330527-29330549 CTATGTGTTTGTGTTGTTGAGGG No data
1155744153_1155744155 -8 Left 1155744153 18:29330512-29330534 CCTAGGAAGCTACAGCTATGTGT No data
Right 1155744155 18:29330527-29330549 CTATGTGTTTGTGTTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155744155 Original CRISPR CTATGTGTTTGTGTTGTTGA GGG Intergenic
No off target data available for this crispr