ID: 1155744156

View in Genome Browser
Species Human (GRCh38)
Location 18:29330531-29330553
Sequence GTGTTTGTGTTGTTGAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155744152_1155744156 -3 Left 1155744152 18:29330511-29330533 CCCTAGGAAGCTACAGCTATGTG No data
Right 1155744156 18:29330531-29330553 GTGTTTGTGTTGTTGAGGGTAGG No data
1155744153_1155744156 -4 Left 1155744153 18:29330512-29330534 CCTAGGAAGCTACAGCTATGTGT No data
Right 1155744156 18:29330531-29330553 GTGTTTGTGTTGTTGAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155744156 Original CRISPR GTGTTTGTGTTGTTGAGGGT AGG Intergenic
No off target data available for this crispr