ID: 1155749242

View in Genome Browser
Species Human (GRCh38)
Location 18:29399246-29399268
Sequence CGGCAAACGGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155749232_1155749242 29 Left 1155749232 18:29399194-29399216 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG No data
1155749235_1155749242 18 Left 1155749235 18:29399205-29399227 CCGGAGGGATGGAAGTCAGCAAG No data
Right 1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG No data
1155749234_1155749242 28 Left 1155749234 18:29399195-29399217 CCTGCTGGATCCGGAGGGATGGA 0: 12
1: 72
2: 118
3: 157
4: 197
Right 1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155749242 Original CRISPR CGGCAAACGGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr