ID: 1155753040

View in Genome Browser
Species Human (GRCh38)
Location 18:29453284-29453306
Sequence CTTTATGTGTAGGCTGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 6, 3: 17, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155753037_1155753040 8 Left 1155753037 18:29453253-29453275 CCCTAAACAAGTGGGAGCATTAC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1155753040 18:29453284-29453306 CTTTATGTGTAGGCTGCACATGG 0: 1
1: 0
2: 6
3: 17
4: 309
1155753038_1155753040 7 Left 1155753038 18:29453254-29453276 CCTAAACAAGTGGGAGCATTACT 0: 1
1: 0
2: 0
3: 3
4: 102
Right 1155753040 18:29453284-29453306 CTTTATGTGTAGGCTGCACATGG 0: 1
1: 0
2: 6
3: 17
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155753040 Original CRISPR CTTTATGTGTAGGCTGCACA TGG Intergenic
901316969 1:8316086-8316108 CTTTATGAGTCCCCTGCACATGG - Intergenic
902521800 1:17022376-17022398 CTTTATTTGTAGGCTACACAGGG - Intronic
909434209 1:75621334-75621356 CTTTATGTGTAGTCTTGGCATGG - Intergenic
910987538 1:93020447-93020469 TCTTATGTGTGGGCAGCACATGG + Intergenic
911103278 1:94110539-94110561 CTTCAGGTATGGGCTGCACAAGG + Intronic
912232227 1:107807584-107807606 CTCTAGGGGTATGCTGCACAGGG - Intronic
913014726 1:114721422-114721444 TTTTATCTGTAGCCTGCACCGGG - Intronic
914740834 1:150463455-150463477 CTGGATTTGTAGACTGCACAAGG - Intronic
915636620 1:157191599-157191621 CTTTAAGTCTGGGCTGCACACGG - Intergenic
919599995 1:199610882-199610904 ATTACTGTGTAGGCTCCACAGGG + Intergenic
919807167 1:201386970-201386992 GTTTCTGTGTGGCCTGCACAGGG + Exonic
921895301 1:220393724-220393746 CCTTAAATGTGGGCTGCACATGG + Intergenic
1064387106 10:14905692-14905714 CTTCATGTTTCGGCTGGACACGG + Intronic
1064658813 10:17584604-17584626 CTTAATGTTTTGGTTGCACATGG - Intergenic
1065178953 10:23105934-23105956 CCATTTGTGTAGACTGCACAAGG + Intronic
1066091493 10:32025664-32025686 ATTCATGTGTAGGCTGAGCATGG - Intronic
1066794178 10:39100539-39100561 CTTTTTGTGTAATCTGCAAAGGG + Intergenic
1069939627 10:71945672-71945694 CTTTATGTGCAGGCAGCAATTGG - Intergenic
1071779313 10:88825471-88825493 ATTTATCTGTAGTTTGCACACGG + Intronic
1075986848 10:126795551-126795573 CCTTAAGTGTGGGCTGCATATGG + Intergenic
1078465857 11:11549841-11549863 CTTCAGGTGTAGGCTGAATAAGG - Intronic
1080263064 11:30371267-30371289 TTTTATGTGTTGGCTTGACAGGG - Intergenic
1082155638 11:48807192-48807214 CTTTTTGTATAATCTGCACATGG + Intergenic
1082604054 11:55201443-55201465 CTTTTTGTATAAGCTGCAAAGGG - Intergenic
1084828348 11:71748545-71748567 ATTTATGTGTAGGCAGCAATTGG - Intergenic
1085978237 11:81687365-81687387 CATTATCTGTAGACTGTACAGGG + Intergenic
1091742400 12:2969128-2969150 CTGTATCTGTAGGTTCCACATGG + Intronic
1095064095 12:37744713-37744735 CTTTTTGTATAATCTGCACAGGG + Intergenic
1095944194 12:47744859-47744881 CCTCATGTGTCGCCTGCACATGG + Intronic
1098770898 12:74551782-74551804 TTTTATGTGTAAGCTTCACTAGG + Intergenic
1098778313 12:74651815-74651837 CTTCAAGTGTGAGCTGCACATGG + Intergenic
1099382919 12:81977068-81977090 CATTATGTATAGGCTGCACATGG - Intergenic
1103168061 12:118787823-118787845 CTTTAAGTGTAGGCTACACATGG - Intergenic
1103218500 12:119223147-119223169 ATTTATATGTAGGCTGGGCATGG - Intergenic
1105791604 13:23805826-23805848 ATTTATGTTGAGGCTTCACATGG - Intronic
1107326849 13:39253362-39253384 CTTTATGTATAGGATGCATTTGG + Intergenic
1107565559 13:41600318-41600340 CTATATTTCTAGGCTGCACCTGG + Intronic
1110412104 13:75215714-75215736 CTTTATGTGCAACCTCCACAAGG - Intergenic
1111546123 13:89738790-89738812 CCTTATGTGTATGGTGCACATGG + Intergenic
1112139211 13:96619830-96619852 CTTTTTGGGTAGGTTGGACAAGG + Intronic
1113399911 13:109981777-109981799 CTTTATGGGTGGGCACCACAAGG - Intergenic
1114000978 14:18245264-18245286 CTTTATGTAGAAGCTGCAAATGG - Intergenic
1115243011 14:31267895-31267917 CCTTATGTGTGGGTTGCACATGG - Intergenic
1117981225 14:61343925-61343947 TTTCATGTTTATGCTGCACAAGG + Intronic
1122931536 14:104935000-104935022 CTTTGTGTGTGAGCTGCACTTGG + Exonic
1124182007 15:27485019-27485041 CTTTAATTGTGGGCTGCACCTGG + Intronic
1124851827 15:33347198-33347220 CCTTAAGTGTAGGCTGTGCATGG - Intronic
1125000280 15:34762757-34762779 CGTTATGTTTAGGCTGGACACGG + Intergenic
1125167486 15:36725026-36725048 CTTTATGTTTGGGCTGCCGATGG - Intronic
1125808040 15:42511459-42511481 CTTCATGTGTTGTCTGAACATGG - Intronic
1127439577 15:58992873-58992895 ATTCATGTTTAGGCTGGACATGG + Intronic
1127661490 15:61103745-61103767 CTTTATGTGTGGGCAACACCAGG + Intronic
1130974085 15:88759516-88759538 CTTCATCTGTAGAATGCACATGG + Intergenic
1135073121 16:19369809-19369831 CCTTAAGTGTAGGCAGCACACGG + Intergenic
1141652962 16:85403318-85403340 CTTTAAGTGTGGGCTGGACCTGG - Intergenic
1142274242 16:89107890-89107912 CTTTATCAGTAGTGTGCACACGG - Intronic
1143993999 17:10991105-10991127 ATTTGTGTTTAGGGTGCACATGG - Intergenic
1147591028 17:41683447-41683469 CTTGATCTGCAGCCTGCACAGGG - Intergenic
1149469470 17:56903998-56904020 CTTTATGGGTGGCCTGCATAGGG - Intronic
1152403885 17:80085615-80085637 CTTTGTGAGTGGGCTGCAGAGGG - Intronic
1152550997 17:81030176-81030198 CCTTCTGTGTGGGCTGCACATGG - Intergenic
1153078885 18:1197219-1197241 CTTTGTGTTTGGGCTGCACTTGG - Intergenic
1154535929 18:15461668-15461690 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154536044 18:15463369-15463391 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154536281 18:15466770-15466792 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154536398 18:15468472-15468494 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154536515 18:15470174-15470196 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154536630 18:15471875-15471897 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154536745 18:15473575-15473597 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154536867 18:15475276-15475298 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154536989 18:15476977-15476999 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154537108 18:15478678-15478700 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154537227 18:15480379-15480401 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154537339 18:15482079-15482101 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154537457 18:15483780-15483802 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154537569 18:15485481-15485503 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154537686 18:15487182-15487204 CTTTATGTGGATTCTGCAGATGG + Intergenic
1154537799 18:15488882-15488904 CTTTATGTGGAAACTGCAAATGG + Intergenic
1154537905 18:15490582-15490604 CTTTATGTGGAAACTGCACATGG + Intergenic
1154538021 18:15492283-15492305 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154538137 18:15493984-15494006 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154538372 18:15497385-15497407 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154538483 18:15499086-15499108 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154538594 18:15500787-15500809 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154538709 18:15502488-15502510 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154538824 18:15504189-15504211 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154538943 18:15505891-15505913 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154539062 18:15507592-15507614 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154539175 18:15509293-15509315 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154539410 18:15512695-15512717 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154539525 18:15514396-15514418 CTTTATGTGGAAACTGCAAATGG + Intergenic
1154539633 18:15516097-15516119 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154539751 18:15517798-15517820 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154539865 18:15519498-15519520 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540093 18:15522900-15522922 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540208 18:15524601-15524623 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540327 18:15526304-15526326 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540449 18:15528005-15528027 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540564 18:15529706-15529728 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540683 18:15531407-15531429 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540801 18:15533109-15533131 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154540922 18:15534810-15534832 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154541061 18:15536806-15536828 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154541301 18:15540208-15540230 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154541417 18:15541910-15541932 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154541533 18:15543613-15543635 CTTTATGTGGAAACTGCAAATGG + Intergenic
1154541652 18:15545314-15545336 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154541773 18:15547015-15547037 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154541893 18:15548716-15548738 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154542016 18:15550416-15550438 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154542137 18:15552117-15552139 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154542481 18:15557221-15557243 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154542597 18:15558922-15558944 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154542718 18:15560623-15560645 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154542834 18:15562324-15562346 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154542951 18:15564025-15564047 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154543070 18:15565726-15565748 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154543187 18:15567427-15567449 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154543305 18:15569127-15569149 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154543423 18:15570829-15570851 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154543646 18:15574230-15574252 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154543763 18:15575930-15575952 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154543996 18:15579332-15579354 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154544229 18:15582732-15582754 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154544349 18:15584434-15584456 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154544465 18:15586135-15586157 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154544579 18:15587836-15587858 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154544701 18:15589537-15589559 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154544814 18:15591238-15591260 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154544929 18:15592939-15592961 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545050 18:15594638-15594660 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545169 18:15596340-15596362 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545285 18:15598041-15598063 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545395 18:15599742-15599764 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545510 18:15601442-15601464 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545620 18:15603143-15603165 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545733 18:15604846-15604868 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154545852 18:15606547-15606569 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154545968 18:15608250-15608272 CTTTATGTGGAAACTGCAAATGG + Intergenic
1154546082 18:15609951-15609973 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154546194 18:15611653-15611675 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154546309 18:15613354-15613376 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154546435 18:15615055-15615077 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154546551 18:15616756-15616778 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154546669 18:15618458-15618480 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154546781 18:15620159-15620181 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154546894 18:15621860-15621882 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154547014 18:15623561-15623583 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154547246 18:15626963-15626985 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154547364 18:15628664-15628686 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154547478 18:15630365-15630387 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154547599 18:15632065-15632087 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154547711 18:15633767-15633789 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154547830 18:15635468-15635490 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154547944 18:15637169-15637191 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154548062 18:15638870-15638892 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154548179 18:15640571-15640593 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154548405 18:15643975-15643997 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154548636 18:15647374-15647396 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154548748 18:15649076-15649098 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154548863 18:15650786-15650808 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154548979 18:15652487-15652509 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154549212 18:15655892-15655914 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154549333 18:15657593-15657615 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154549448 18:15659294-15659316 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154549565 18:15660995-15661017 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154549680 18:15662696-15662718 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154549915 18:15666100-15666122 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154550034 18:15667811-15667833 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154550150 18:15669512-15669534 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154550267 18:15671213-15671235 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154550388 18:15672915-15672937 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154550504 18:15674617-15674639 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154550623 18:15676318-15676340 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154550857 18:15679721-15679743 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154551095 18:15683126-15683148 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154551209 18:15684827-15684849 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154551446 18:15688231-15688253 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154551562 18:15689932-15689954 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154551677 18:15691633-15691655 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154551791 18:15693334-15693356 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154551906 18:15695036-15695058 CTTTATGTGGAAACTGCAAATGG + Intergenic
1154552021 18:15696736-15696758 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154552133 18:15698437-15698459 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154552247 18:15700138-15700160 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154552362 18:15701838-15701860 CTTTATGTGGAAACTGCAAATGG + Intergenic
1154552477 18:15703539-15703561 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154552593 18:15705240-15705262 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154552823 18:15708642-15708664 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154552936 18:15710343-15710365 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553056 18:15712044-15712066 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553178 18:15713745-15713767 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553408 18:15717149-15717171 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553524 18:15718849-15718871 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553639 18:15720550-15720572 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553758 18:15722253-15722275 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553873 18:15723954-15723976 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154553987 18:15725657-15725679 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154554110 18:15727358-15727380 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154554230 18:15729059-15729081 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154554461 18:15732462-15732484 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154554583 18:15734162-15734184 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154554696 18:15735863-15735885 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154554809 18:15737564-15737586 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154554932 18:15739266-15739288 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154555049 18:15740966-15740988 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154555164 18:15742667-15742689 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154555280 18:15744369-15744391 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154555404 18:15746071-15746093 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154555638 18:15749473-15749495 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154555752 18:15751185-15751207 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154555949 18:15754078-15754100 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154556062 18:15755778-15755800 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154556179 18:15757479-15757501 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154556412 18:15760883-15760905 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154556531 18:15762585-15762607 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154556764 18:15766004-15766026 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154556888 18:15767708-15767730 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154557010 18:15769409-15769431 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154557128 18:15771109-15771131 CTTTATGTGGAATCTGCAAATGG + Intergenic
1154557236 18:15772809-15772831 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154557355 18:15774511-15774533 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154557468 18:15776212-15776234 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154557584 18:15777914-15777936 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154557704 18:15779615-15779637 CTTTATGTGGAATCTGCAGATGG + Intergenic
1154801326 18:19123296-19123318 CTTTTTGTGGAGTCTGCAAATGG + Intergenic
1155753040 18:29453284-29453306 CTTTATGTGTAGGCTGCACATGG + Intergenic
1155889126 18:31244576-31244598 CTTTTTGTGTGTGCTGCACTTGG + Intergenic
1156272708 18:35551736-35551758 CTTTATGTGTATGTGGCATATGG - Intergenic
1159563418 18:70020758-70020780 CTCTATGTGTAGCTTGAACAGGG + Exonic
1159845649 18:73456529-73456551 CCTTAAGTGTGGGCTGCACATGG + Intergenic
1159878708 18:73837581-73837603 TTTTATGTGTATTTTGCACATGG - Intergenic
1161213024 19:3077634-3077656 ATTTATGTGTGGGCTGGGCACGG - Intergenic
1161371897 19:3917095-3917117 GTTTATGTGTTGGCTGAGCACGG - Intronic
1163077020 19:14902631-14902653 CTTTCTGTGTAGACTACACTAGG + Intergenic
1164351446 19:27348609-27348631 CTTTTTGTGTAATCTGCAAAGGG - Intergenic
925479899 2:4258866-4258888 CTTTATGTGTTACCTGCACTGGG + Intergenic
926955905 2:18299530-18299552 TTCAATGTGTAGGCTGGACATGG - Intronic
930663587 2:54080209-54080231 CCTTATCCGTAGGCTGCACATGG + Intronic
932378937 2:71264239-71264261 GTATATGTGTAGGCTGGGCACGG - Intergenic
934047713 2:88186184-88186206 CTTAATGGGGAGGGTGCACAAGG - Exonic
935801426 2:106700602-106700624 CCTTAAGTGTGGGCTGCACAGGG + Intergenic
937398239 2:121557790-121557812 TATTATGTGTAGGCTGGGCACGG + Intronic
939520828 2:143228277-143228299 TTTTATGGGAAGGATGCACATGG + Intronic
944041419 2:195359351-195359373 CTGTTTGTCTAGGCTGCAAAAGG + Intergenic
948338081 2:237226839-237226861 CATTAAATGTAGGCTGCACATGG - Intergenic
1171741827 20:28904166-28904188 CTTTATGTGGAATCTGCAAATGG + Intergenic
1172103551 20:32501032-32501054 CTTCAGGTGTGGGCTGCACACGG + Intronic
1174257061 20:49264631-49264653 CTTTCTGGGTAGGCAGCCCAGGG - Intronic
1176427161 21:6555339-6555361 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1177651677 21:23967064-23967086 CTTTAGGTGTAGGCACCTCAAGG + Intergenic
1178710878 21:34915462-34915484 ATTTGTGTTTAGGCTGGACAAGG - Intronic
1179702652 21:43163657-43163679 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1180425489 22:15176062-15176084 CTTTATGTAGAAGCTGCAAATGG - Intergenic
1181092740 22:20485390-20485412 CTTTCTGTGTACTCTGTACATGG - Intronic
951530197 3:23691846-23691868 CTTTATGTGTAGGCTGGACGTGG - Intergenic
952870989 3:37901232-37901254 CTTTCTGTGTATGCTCCAAAGGG + Intronic
953733942 3:45475284-45475306 TTTTGTGAGGAGGCTGCACAGGG - Intronic
953914853 3:46911749-46911771 CTTTATTTGTAGGTTGCCAAAGG - Intergenic
955506939 3:59641839-59641861 CTTTCTCTGCAGGCTCCACATGG + Intergenic
955519842 3:59764501-59764523 ATGGATTTGTAGGCTGCACAGGG - Intronic
960156020 3:114297824-114297846 CTTTGTGGGGAGGCTGCACAGGG - Intronic
965800158 3:172484209-172484231 AGTTATGTATAGGCTGGACAGGG + Intergenic
969692666 4:8712308-8712330 GTTTATTAGTAGGCTGGACATGG - Intergenic
973054850 4:45642736-45642758 CTTTATGTCTATGCTTCACCTGG + Intergenic
973598058 4:52512875-52512897 CTTTTTTTGTAGGCTGGGCATGG + Intergenic
974039792 4:56847574-56847596 CTTTAAGTGTCAGCTGAACAAGG - Intergenic
976361157 4:84179896-84179918 CTTTAGGTGTGGGCTGCATGTGG - Intergenic
977870844 4:102088878-102088900 CTCTATGTTTGGGCTCCACATGG - Intergenic
979994448 4:127413778-127413800 CTTTGTGTTTAGTTTGCACATGG + Intergenic
980124967 4:128765518-128765540 CCTTGAGTGTGGGCTGCACAAGG + Intergenic
982420633 4:155192851-155192873 ATTTCTGTGTAGGCTGTAGAAGG + Intergenic
982525560 4:156473581-156473603 CTTTATCTGTACTCTGGACAAGG + Intergenic
983132405 4:164037639-164037661 CTTTAAGTGTGGGCTGTGCATGG + Intronic
984068190 4:175076729-175076751 ATTTATGTGTAGGCAGAAAAAGG - Intergenic
986512645 5:8524538-8524560 CTTCCTGTGTAGGGTGCCCAAGG + Intergenic
986995361 5:13601581-13601603 CTTTGAGTGTTGGCTGCTCATGG + Intergenic
991295209 5:65073207-65073229 CTTTATGTGGAGTCTGGAAATGG - Intergenic
993240145 5:85372523-85372545 CTTAATGTTTATGCTGCAAATGG - Intergenic
993497484 5:88623624-88623646 CTTTAAGTGTAGAGTACACATGG + Intergenic
994224208 5:97233055-97233077 CTTAATTTTTAGGCTTCACATGG - Intergenic
999856433 5:155599828-155599850 TTTTATTTGTTGGATGCACAGGG - Intergenic
1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG + Intergenic
1003469817 6:6418885-6418907 CTTTAAGTGCAGGCTGCACACGG - Intergenic
1003509299 6:6765950-6765972 CTTTATTTATAGGCTGGGCACGG + Intergenic
1003941022 6:11026719-11026741 CTTTATATGTATGCAGCATATGG + Intronic
1008147390 6:47908085-47908107 CTTTGTGTGTGGGCTACTCAGGG - Intronic
1009254714 6:61371775-61371797 CTTTTTGTGTAGTCTGCAAGTGG + Intergenic
1010836541 6:80594779-80594801 CTTAATGTTTAGGCTGCTTAGGG + Intergenic
1012045489 6:94267218-94267240 TTTTATGTGTGGCCTGCGCAGGG + Intergenic
1013978625 6:116103980-116104002 CATAATTTGTAGGCTGCATATGG + Intronic
1015065122 6:129015691-129015713 CTTTTTATGTAGTCTGCACTAGG + Intronic
1016936811 6:149454051-149454073 CTGTATGTGCAGGCAGCACCTGG - Intronic
1023345593 7:39268121-39268143 TTTTATGTGTTGTCTGCATAGGG + Intronic
1023714110 7:43025904-43025926 CCTTGTGTGTAGGGTGCACATGG - Intergenic
1024283134 7:47735893-47735915 CTTAATGTGTTGCCTGCTCATGG - Intronic
1027267616 7:76502925-76502947 CTTCATGTGTAGGCTGCTGTGGG - Intronic
1030456651 7:109782983-109783005 CTTTGAGTGTGGGCTGCACCTGG - Intergenic
1032347307 7:131128154-131128176 CTTTATGTTCAAGCTGCATATGG - Intronic
1033536455 7:142316734-142316756 TTTTATGTGTATATTGCACAGGG + Intergenic
1036682141 8:10883241-10883263 CTTTAGGTCTGGGCTGTACAAGG + Intergenic
1039816526 8:41099622-41099644 CTTTATGTAGAGGCTGAGCAGGG - Intergenic
1040129354 8:43776402-43776424 CTTTATGTGGAGTCTGCGAAGGG + Intergenic
1040131249 8:43799322-43799344 CTTTTTTTGTAGTCTGCAAAGGG + Intergenic
1043850337 8:85209198-85209220 CTTTATTTATAAGCAGCACATGG - Exonic
1043850993 8:85216384-85216406 ATCTATGGGTAGGCTGCATAAGG - Intronic
1046025050 8:108712253-108712275 CTTTAGGGATACGCTGCACATGG + Intronic
1046227394 8:111301503-111301525 ATTTATATGAAGGCTGGACATGG - Intergenic
1046387630 8:113524580-113524602 CTGTTTGTCTAGGCTGCTCAGGG + Intergenic
1054721092 9:68604704-68604726 CCTTAAGTGTGGGCTGCAGATGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055492927 9:76824942-76824964 CCTTGTGTGTATGCTGCACAAGG - Intronic
1056438133 9:86593087-86593109 CTTTAAGTGTAGACTGGACTTGG - Intergenic
1056554280 9:87676138-87676160 CTAGAGGTGTTGGCTGCACATGG + Intronic
1056809526 9:89753561-89753583 CCTTATGTGTAGGGTCCACTGGG + Intergenic
1203356075 Un_KI270442v1:146643-146665 CTTTTTGTATAATCTGCACATGG - Intergenic
1203413605 Un_KI270589v1:23564-23586 CTTTATGTGTATTCTGCAAGTGG - Intergenic
1203413869 Un_KI270589v1:29408-29430 CTTTATGTGTATTCTGCAAGTGG - Intergenic
1203684410 Un_KI270757v1:30470-30492 CTTTATGTGTATTCTGCAAGTGG + Intergenic
1203684706 Un_KI270757v1:35648-35670 CTTTATGTGTATTCTGCAAGTGG + Intergenic
1185818348 X:3178227-3178249 TTTTACATGTAGGCTGCCCATGG + Intergenic
1189592478 X:42529768-42529790 CTTTTTGTTTTGTCTGCACATGG + Intergenic
1191108147 X:56784995-56785017 CTGGATGTGTAGGCCGCACTGGG + Intergenic
1191109795 X:56795543-56795565 CTTGATGTGTAGGCTGCACTGGG + Intergenic
1191111324 X:56804965-56804987 CTGGATGTGTAGGCTGCACTGGG + Intergenic
1193968660 X:88022190-88022212 CTTCATCTGTAGACTGAACATGG + Intergenic
1195004196 X:100670482-100670504 ATTGCTGTGCAGGCTGCACAGGG - Intronic
1195201789 X:102558193-102558215 CTTTATGTACAGCTTGCACAGGG + Intergenic
1196284844 X:113867399-113867421 TTGTGTGTGTAGCCTGCACATGG + Intergenic
1197089636 X:122521359-122521381 CTATGTCTCTAGGCTGCACATGG + Intergenic
1198470685 X:136943635-136943657 CCTTATATATGGGCTGCACAAGG - Intergenic
1198941422 X:141960901-141960923 CTTTAAGTGTAGGCTGTCCAAGG - Intergenic
1199246958 X:145616365-145616387 CATTATTTGTCTGCTGCACACGG - Intergenic